[ 3 / biz / cgl / ck / diy / fa / ic / jp / lit / sci / vr / vt ] [ index / top / reports ] [ become a patron ] [ status ]
2023-11: Warosu is now out of extended maintenance.

/sci/ - Science & Math

View post   
File: 178 KB, 540x1867, 1294195735031.gif [View same] [iqdb] [saucenao] [google]
2324993 No.2324993 [Reply] [Original]

I want to get my genome sequenced, I don't care about price.

I saw this https://www.23andme.com/ but it isn't comprehensive enough.

I want to know every goddamn letter of my DNA.

Anybody know where or how I could get this done?

>> No.2324997

>>2324993
There are only 4 of them.

>> No.2325003
File: 48 KB, 451x339, 1289564802946.jpg [View same] [iqdb] [saucenao] [google]
2325003

>>2324997

>> No.2325004

okay are you ready ?

ACGTCGGGCCCATCAGCATCGACTAGCATCAGCATCTATAATTTACGGGCAGGCAGAGGGCAGAAAAATTCTCTTAGCGAGCTATCAGCATCGACTACTA
CTTATTACGAGACGAFAGCATCAGCAGCGACGCGAGCAGCATCAGCGTGTGCAGAGCGACGAAAGCATCAGCACTACGACTACGACTGCACTACTGACAC
ACTACTACTGACTGAC

>> No.2325010

>>2324993
sure, just fork over the $100k - $1M

>> No.2325012

You should know that there are no complete human genomes around for any price.

http://nextbigfuture.com/2010/12/interview-of-gene-sequencing-expert.html

These guys will do a complete one soon.
But I would wait, the price will come down fast, and right now there's not much you can do with the information.

>> No.2325013

>>2325004

waiting on the other couple billion

>>2325010

it doesn't cost that much and if it did to whom would I be forking this over to?

>> No.2325024

>>2325012

hmmm... I see. So if I contacted this individual I'd have the closest possible sequence to fully complete, as our current technology allows?

And it'd cost about 10k?

>> No.2326606

If I were to sequence my DNA, I'd patent it and then sue my children.