/sci/ - Science & Math

[Anonymous No.14763438]

What's the ACTUAL deal with covid vaccines and "I was triple jabbed and still got sick/countries like Israel with a fully and always vaccinated population still gets spikes?"

Please no /pol/ shit, there's a reason I didn't post on that fuckboard

[Anonymous No.14763452]

Federal courts have recently started ruling that drawn or animated child pornography is just as illegal as photographic child pornography and that the people who posses, watch or trade in non photographic child pornography are criminals and subject to punishment just as much as those involved with photographic child pornography.

[Anonymous No.14763476]

>>14763438
Looking at the data available:
Great protection against the ancestral type.
Possible to catch Delta, personally I'm not sure if it's due to fading immunity or Delta being somewhat different. Boosting helps though.
No neutralizing antibodies against Omicron, it's a new serotype. However, neutralizing antibodies is just the first line of defence. There still seems to be an effect, shown for example here:
https://www.thelancet.com/journals/laninf/article/PIIS1473-3099(22)00345-0/fulltext
tl;dr: The newer the virus, the less the effectiveness (Okay effect for BA.1, the older omicron, less for BA.2, probably even worse for BA.5). Also, boosting improves the effectiveness.

None of that means that you can't get sick when triple or quadruple jabbed, but the risks are lower. It seems like the risk of dying or severe complications is also lowered.

Now, the less scientific, but more political question is, should you get it? In addition to all the immunity shenanigans, Omicron also is much less harmful than the older covid types. So even if you're "only" double jabbed, the risk of anything severe is quite small. Probably up to you. The even more political question: Do we need it for society? Probably not. The first few variants hit a mostly naive (i.e. no immunity) population while putting a part of them in hospitals or graves. Now we have a less severe variant and a more immune population. It's unlikely that our ICUs will reach their capacity limits with free-running omicron waves. That's why vaccine mandates are pretty out of fashion since Omicron.

[Anonymous No.14763596]

>>14763438
>please educate me on the vaccines
>please don't educate me on the vaccines
pick one
https://iceni.substack.com/p/the-spartacus-letter

[Anonymous No.14763610]

>>14763596
Only /pol/ believes VAERS.

[Anonymous No.14763658]

>>14763596
>VAERS
In the trash it goes.

[Anonymous No.14763698]

>>14763610
>>14763658
What's a good analogy for why VAERS is not research and shouldn't be treated like it?

[Anonymous No.14763719]

>>14763698
Moot becoming Time person of the year.

[Anonymous No.14764395]

>>14763452
Based. It's time to remove these nonces

[Anonymous No.14764403]

>>14763438
Do you ever consider the possibility that a significant amount of people are sheep prone to mass psychosis and will without question just copy whatever they percieve to be the prevailing consensus?
Perhaps the theater around covid was simply an experiment to see how well mass psychosis can be made from a virus no worse than the bird flu, swine flu etc.

[Anonymous No.14764559]

>>14763438
Look up Schmuel Shapira's twitter after you read on his credentials and involvement with the covid vaccination in israel

[Anonymous No.14764636]

>>14763438
>What's the ACTUAL deal with covid vaccines
You know, perhaps you don't want to admit it.

MONEY
POWER
CONTROL
BIOGENICS
EXPERIMENTATION
COMPLIANCE
POPULATION REDUCTION

[Anonymous No.14764846]

Even the original Pfizer docs say it's a shitty vaccine at bets and terrible for your health at worst.
They even made up a whole facility to massage numbers.

[Anonymous No.14765166]

>>14763438
>What's the ACTUAL deal with covid vaccines
A non exitend virus, diagnosed with an unsuited test were primers and repetition rate makes idiotic false positives to inject you with an experimental juice which has severe side and unknown long term effects. The whole faculty keeps silent as cowards they are about that and politicians, media and some dwarf freaks gets contra dictionary statements all the time.

The actual deal is the end of western civilisation. It is the end of democracy, science and polite interaction.This flu has shown that there are only assholes retards and parasites left. Exceptions confirm the rule

[Anonymous No.14765183]

>>14764403
Thats what I think personally, even at its worst two years ago it always seemed like what swine flu/H1N1 back in 2009 would have been like if everyone collectively lost their goddamn minds, and it didn’t help that this decade was charged as all hell before and after on virtually every front. Now even Pfizer and Moderna are saying the shots do nothing, but somehow this stuff is on the same level as the polio or smallpox vaccines just because its also one. The whole thing is absurd and was all the proof I needed to realize we are collectively doomed from both rampant greed and rampant retardation.

[Anonymous No.14765193]

This is how I understand immunity. There are two parts to immunity. One part, is your immune system identifies the virus and learns how to make antibodies. The other part, is actually making the antibodies to fight the virus. Your body remembers how to make antibodies permanently, whereas your body may or may not be making the antibodies at any given time. Your body will generally _stop_ making antibodies when it doesn't detect the virus anymore.

For covid, and the flu, and many cold viruses, two things happen:
1. Your body stops making antibodies pretty soon after the infection ends (~6 months).
2. These viruses are really good at infecting you quickly.

What happens is your body stops making antibodies, and then you get infected a second time so quickly that your body does not have enough time to start producing antibodies.

I think that is what is going on.

[Anonymous No.14766928]

>>14763719
kek

[Anonymous No.14767000]

>>14765166
Is this a copypasta or do you have to write that garbage every time by hand?

[Anonymous No.14767236]

>>14763438
ADE & OAS
It's the future you chose

[Anonymous No.14767423]

>>14763698
Did you know that 1 in 7 people die on a tuesday? We need to do something to stop this dangerous day.

[Anonymous No.14767427]

>>14763438
viruses don't exist, stupid schizo

[Anonymous No.14767681]

It was never a vaccine. It was just an experimental drug pharma could sell for billions and an excuse for politicians to increase their power over the populous. That is the actual deal.

[Anonymous No.14767701]

>>14763438
How can a vaccine make you deaf?
Paul Ryder was going deaf 48 hours before his death https://www.dailymail.co.uk/tvshowbiz/article-11120343/Shaun-Ryders-brother-Paul-going-deaf-48-hours-death.html?ito=native_share_article-masthead

[Anonymous No.14768074]

>>14767681
You were never human, yet your parents tolerated you for a while.

[Anonymous No.14768077]

>>14767701
>dailymail

[Anonymous No.14768078]

>>14768074
Why are you mad?

[Anonymous No.14768095]

>>14767701
>years of street drugs
>yeah must've been the vaccine
>literally billions vaccinated and still hearing fine
>yeah the vaccine makes you deaf

[Anonymous No.14768342]

>>14767000
Written it for the first time, what's your meds against your shizo hallus?

[Anonymous No.14768349]

>>14763438

[Anonymous No.14768411]

>>14763438
It's now quadruple-jabbed

[Anonymous No.14768760]

>>14767423
All of those people clearly died from Tuesday, we need a Tuesday vax stat

[Anonymous No.14769972]

>>14768078
Because he's been triple boosted and anti vaxers aren't dying in droves and he's probably got monkey pox from the fag sex he has

[Anonymous No.14769979]

>>14763610
>>14763658
>nobody has collected reliable evidence that these vaccines are safe, so just TRUST THE SCIENCE you stupid chud!
VAERS is a shit database but it's also the only centralized adverse event reporting system that was mandated by the government because pharmaceutical companies couldn't be trusted to do their own appropriate safety testing so it's darkly hilarious that VAERS is now a "conspiracy theory" that can't be trusted.

[Anonymous No.14770110]

>>14763476
From a political slant, it was a pretty poor demonstration of risk assessment. Zero nuance on the risk profile of the virus for old people, obese, and younger/healthier demographics - just a one size fits all approach for lockdowns and vaccines that has shown itself to be problematic as time passed. It's far more evident when considering children under 5 in which most parents are not vaccinating - extremely low complication rates despite the CDC pushing to get them vaccinated.

From the very start they should have recommended just the high-risk stay isolated and strongly recommended the vaccine for those who were high risk/closely interacting with high risk (though it's questionable for the latter since the shots are only good for the individual reducing symptom severity and not necessarily spreading the virus).

Which is shameful since all that has transpired will further sink trust in public health and reinforce the beliefs of/create new actual antivaxxers; though I suppose with the new definitions now, anyone who's skeptical of the mandates or is not fully up to date on their shots is an antivaxxer.

[Anonymous No.14771483]

>>14763610
what else should be used as monitoring system?

[Anonymous No.14771500]

>>14763610
Ok, then where can we get third party data about vaccine effects not funded by pharma?

[Anonymous No.14771513]

>>14771500
Almost none of the studies are funded by pharma. In fact, pharma only funds those studies necessary for approval. They're not a charity who do all sorts of research and publish it for free. So we already have such data and studies.

But let's assume for a second that after approval Pfizer did go out of their way and voluntarily did some random research into rare side effects. You're implying that they forge data (big no-no, fraud can get you behind bars), so let's assume they do. What can they gain from this? They already got their approvals. They already got their contracts. I think, Switzerland ordered several times as many doses as they used in the end. No idea about other countries. What difference would a forged paper "the vaccine doesn't give you haemorrhoids" make? They wouldn't sell a single vail more. And if the research isn't forged and there's a nonzero risk to find out that it actually does give you haemorrhoids. That would severely harm their business. What business spends money to hurt itself, or (best case scenario) make no impact whatsoever?

[Anonymous No.14771518]

>>14771513
>You're implying that they forge data
They did
>What can they gain from this?
Billions of dollars, and no liability for adverse affects.
How is this hard to understand? There is literally ZERO INCENTIVE for them to create accurate studies. These are the same people that charge ridiculous amounts for rebranded 20 year old medicine, promoted opiate addiction, and shills drugs to children and snake oil to desperately ill people. They do not care about your health.
We should by default not trust them and take any complaints seriously.

[Anonymous No.14771522]

>>14770110
>Zero nuance on the risk profile of the virus for old people, obese, and younger/healthier demographics - just a one size fits all approach for lockdowns and vaccines that has shown itself to be problematic as time passed.
>Lockdowns
Not /sci/entific reasons, but politically it's incredibly hard to justify a lockdown based on age or BMI. At least the age thing would have failed in front of most supreme courts in the world. BMI is also hard to justify, but I'm not aware of any constitution forbidding discrimination against fat people. Thirdly, quarantine, isolation and "lockdowns" legally don't protect the vulnerable by locking them up, but they are meant to reduce the number of infections. That's why they could close locations with potential for mass infections (clubs), put people who might be infected in quarantine (after travel or contacts) or the infected in isolation. Focussing on the risk groups and just locking them up would go against every infection legislation I'm aware of. I know, this might seem interchangeable, but most laws banning something are to protect others, not the person they affect. You can drink poison. You can't pour it into a river. If you can't buy it, that's because they want to stop you from poisoning others, not yourself. So there's no legal basis to tell an old person "you can't go out, it's dangerous". There is however a basis to tell people in general "you can't go out, you might be a danger to others"
>Vaccine
There was and still is nuance. High-risk groups got it first, and both approval and official recommendation was independently studied for different age groups. It took almost a year until kids could get vaccinated (here), because both the risk profile without the vaccine needed to be evaluated, but also possible adverse events. Only then was it approved and later recommended. And today, old folks get a recommendation for a 4th jab while doing people don't.

[Anonymous No.14771527]

>>14763438
I originally had a much longer post but my internet sperged out and I’m not gonna type all that shit again
So instead
Cope /pol/tards

[Anonymous No.14771533]

>>14771483
Controlled studies with proper analysis. If you have a group of 100 people50 vaccinated and 5 vaccinated people step in dog shit, can you blame the vaccine? Not unless you check up on the other group. Is it 10 people? 5? Zero? Also, what's the chance that people report it? Do the people call you when it happens? Are they equally likely to do so? Maybe 5/5 unvaccinated people call you, but only 1/5 of the vaccinated. Your data looks like "the vaccine prevents 80% of dogshit incidence" when in reality you just suffer from reporting bias.

It's hard to model a control sample for the VAERS data, you'd have to reconstruct it from data of the general population, and most of these /pol/ posts don't even do that. And it doesn't take into account the reporting probability. If somebody died 2 weeks after a flu shot in 2019, would anyone bother to even make the connection or report it? Probably not. But with all eyes on Covid and the Covid vaccine, the chance of a death after vaccination (coincidental or caused by it) is likely much higher. The fact that we don't know that number shows the problem: we simply have no way of telling how reliable the data is, so we must consider the data unusable unless proven different. Posts like >>14763596 are either pretty dumb, or actively trying to create a certain narrative.

[Anonymous No.14771536]

>>14771527
>11.6% of the population are responsible for 65.4% of the...
I think /pol/ is very skilled in making deductions from this :^)

[Anonymous No.14771537]

>>14763476
unironically fpbp

[Anonymous No.14771538]

>>14771536
Yea, fat people.

[Anonymous No.14771550]

>>14771538
Unvaccinated people are fat?
Source.

[Anonymous No.14771556]

>>14771550
Its well documented that fat an old people almost exclusively die from COVID. If you are under 50 you have a less than 1% chance of death. If you are under 30-ish your chance is less than a tenth of a percent.

[Anonymous No.14771564]

>>14771556
You're muddying the waters. Why are the unvaccinated responsible for 65.4% of the deaths if they only make up 11.6% of the population?

If the fat only made up 11.6% of the population and made up 65.4% of the deaths, there would be a straight-forward answer. Being fat is a risk factor. So, is being unvaccinated a risk factor?

[Anonymous No.14771579]

>>14771564
You think 80% of people are vaccinated? Where do they get such a number?
Why does this chart even list the "Percent of population" in the first place?
What determines a COVID 19 death?
Why are all the dates different?
Clearly they wouldn't include persons suffering adverse vaccine affects or "suddenly died" with no pre-existing conditions.
By their own chart, this is saying less than 1% of the people who tested for COVID 19 died while unvaccinated.
They are including 12 years old up, which means they are hiding the fact the the only people dying of COVID who are unvaccinated are the few fat and old people that didn't get vaccinated. Where is the break down of unvaccinated by age group? They clearly have that information.

[Anonymous No.14771585]

>>14771533
kek level shill. Pharma didn't test their drugs and now you want to pull punches for your regulatory daddy which refused sufficient compliance from manufacturers. Disqualify the only tracking data there is because the decades long history of the flu shot might be inaccurate therefor experimental gene therapy is safe and effective.
Die.

[Anonymous No.14771677]

>>14771527
my fucking sides. are the "vaccination status" as of February 2021 or as of June 2022?

[Anonymous No.14771701]

>>14771533
> extremly rare sponanous event happens that otherwise rarely occurs in healthy people
> unexpected event
> like clots that kill
> myocarditis

> all chronologically close to an other event
> which normally not occured and is a special event

> stepping in dogshit literally happens to everyone regardles of health
> stupid argument

> getting a heart attack randomly while beeing healthy and <40 is like a 0.01%
> getting a heart attack randomly after special event is a Abnormality from the norm
> these are collected
> in the early warning system to find signals which are abnormal

So whats wrong with it?
These alerting systems are exactly for that.
> everything we missed during the Studies

This thing is for after the studies.

also get booted my friend

[Anonymous No.14771733]

>>14763438
vaccines were made for WUHAN strain, if everyone was somehow magically vaccinated before the mutations arrived the pandemics would've been suppressed.

however, in reality, vaccines can't catch up on such rapidly mutating virus, so it was always known they will not kill pandemics. it is a nice PR for some companies that made a ton of money. vaccines do help to prevent serious diseases, but they were made before it was understood that covid is not a respiratory disease but a cardiovascular one, and far before mechanism of covid affecting blood vessels was studied in depth, so it's really a question of what sideeffects one can expect from massive doses of spike protein in your system or the novel antigen introduction method (all vaccines, and all drugs have sideefects, for covid that's something not studied extensively enough)

[Anonymous No.14771819]

>>14763438
>Vaccinate everyone for a virus that only affect the really old and frail.
Which we due to all welfare States in Europe have more than enough off.
>Be surprised when they still die
Okay now it gets silly

Basically medicine is a bit of a scam which only accelerates idiocracy.

[Anonymous No.14771835]

>>14771733
>vaccines were made for WUHAN strain, if everyone was somehow magically vaccinated before the mutations arrived the pandemics would've been suppressed.

How can you know?
We didn't had a study. And the same Quarter the vaccine arrived delta became dominant and the vaccine didn't do shit.

> How do you even know it was effective in the first place against the original variant?

The original pfizer trial (which is not finished yed) just put out a early press releases with early studiy data, by observing 40k people between July 27, 2020, and November 14, 2020 and a cut off date of October 9 (meaning everything after that does not count).
> which result in 74 days of observation
https://www.nejm.org/doi/full/10.1056/nejmoa2034577

And this is not a lot of time and the wrong seasons to show a alleged respiratory virus' impact because:
> what do 74 days of observation show in the context of a 2 year + pandemic?
And people only count as vaccinated 7 days after the second shot.

So 74 days - 21 days (first shot and then second) - 7 days = 46 days.

SO in total they only observed vaccinees 46 days to establish a efficacy of 97% for a multi year long pandemic?

Can you kind of help me out with understanding
> how 46 days of beeing vaxxed in late summer and early autumn prove
> that a vaccine protects people against a disease which mostly ravages in the winter?

Can you elaborate on that and how this makes you believe that the vaccine was working at all?
Since the rollout I only read "oh its a break through infection but it could have been worse".

[Anonymous No.14771842]

>>14763438
Efficacy is likely greatly exaggerated. The RCT data on Efficacy was when spread was small ie only around 1% spread in population.

People overlook this. It doesn't appear to have the same protection currently. People assume it's because variants. Not because the protective effect is less noticeable when more spread is going around.

When peoplw catch it, not just once but several times can you still expect 95% Efficacy, from a time when 1% got it?

Probably no, that would mean unvaccinated catch it over and over some 10 times more. When in reality you get some immunity the first time.

[Anonymous No.14771871]

>>14771585
>Pharma didn't test their drugs
Objectively false.
>Disqualify the only tracking data there is
Data with no control group or background sample is worthless. I'm not disqualifying it, it's just scientifically not usable. Why are there so many tourists here?

[Anonymous No.14771874]

>>14771677
At the time of infection, brainlet

[Anonymous No.14771877]

>>14771842
there's nothing to spread infp lol, shill

[Anonymous No.14771880]

>>14771701
> getting a heart attack randomly while beeing healthy and <40 is like a 0.01%
What's the chance to get a heart attack after the vaccine?

[Anonymous No.14771932]

>>14771880
We don't know because we only have VEARS and are not allowed to use the date bacause "le bad data".

We just have unusual increases of all cause mortality.
And we are not allowed to conduct any analylsis with the only data we have.

And according to german observation:
Its 1 in 5000 shots causes a severe adverse event
https://www.israelnationalnews.com/news/356900

But sadly we are not allowed to look since the "data is shit" so we act like the data is not there, and just go on and repeat the same thing like in the last year.

[Anonymous No.14771940]

>>14771835
>How can you know? We didn't had a study.
We did have results prior to the admission you clown.

>delta became dominant and the vaccine didn't do shit.
Liar.
>With the BNT162b2 vaccine, the effectiveness of two doses was 93.7% (95% CI, 91.6 to 95.3) among persons with the alpha variant and 88.0% (95% CI, 85.3 to 90.1) among those with the delta variant.

>in total they only observed vaccinees 46 days to establish a efficacy of 97% for a multi year long pandemic?
No, moron. They establish (95% credible interval, 90.3 to 97.6), it's in the article that you linked.
What does the duration have to do? They tested efficacy, not longterm efficacy. Would you want them to sit on their data for years in the middle of a pandemic? If you have 162 occurrences in the control group and 8 in the test group, what's the number you'd state? How would you determine the uncertainty? In a very simplified (and incorrect) approximation, I get 90.1 to 98.7% (especially the upper bound it's affected by my approximation).

[Anonymous No.14771954]

>>14763438
You don't need statistics or research to have motivations not to take these particular vaccines.

Pharma companies are criminal, as are most governments. The amount of censorship and coercion in the past two years should be incredibly alarming for everyone. The vaccines themselves are closed-source. You can take the vaccines at any time but you can never un-take them.

[Anonymous No.14771971]

>>14771932
>we only have VEARS and are not allowed to use the date bacause "le bad data".
I'm explaining why it's bad, not forbidding you to use it. But if you use it, at least do your best. Oh wait, you don't have to do it, others have:
https://www.thelancet.com/journals/laninf/article/PIIS1473-3099(22)00054-8/fulltext
4496 Deaths for 300 million doses isn't so much.
>In our review and analysis of death reports to VAERS following mRNA vaccination, we found no unusual patterns in cause of death among the death reports received.
I bet the same pattern occurred after my last birthday.

[Anonymous No.14771974]

>>14771940
>What does the duration have to do?

why didn't they look just 7 days?
If time doen't matter.


> time does matter becaause out of 42k people only 170 got a positive test.

So during a 74 days they had only 0,4% of test subjects infected in total.
This is a insignificant number in the context of a pandamic and also a disease in which you cannot predict when it hits.

If they would vaccinate people and after the 7 days of "immunization" would manually infect all them with a cultured virus, so it's 100% sure they all have exposure then ok.

But this thing has the whole uncertainty of:
> are the subjects even exposed?

This shit does not say anyting its way to uncertain and inaccurate.
> In the vaccine group, 8/18,198 got Covid-19 infection (not death) = 0.044%
This is the EER (Experimental Event Rate)

> In the Control (placebo) group, 162/18,325 got covid-19 infection (not death ) = 0.884%
This is the CER (Control Event Rate)

> ARR (Absolute Risk Reduction) = CER – EER = 0.884% – 0.044% = 0.84% = 0.84/100 = 0.0084
> RRR (Relative Risk Reduction) = ARR divided by CER or 0.84% divided by 0.884% = 0.95

>As this formula involves division, the percentage signs cancel out. 0.95 is the same as 95% which is what the Pfizer study reports for “efficacy.” An “efficacy” of 95% gives the impression that one is 95% less likely to catch Covid-19 if one is vaccinated with Pfizer’s Covid-19 vaccine. However,

> the ARR or Absolute Risk Reduction, which is 0.0084 or 0.84%, is actually less than 1%

>Another way of understanding the ARR is by calculating the number needed to treat, or the NNT. The NNT in this case would be the number of people who would need to be vaccinated to prevent ONE case of Covid-19 infection (not death, since the study did not measure death) Here is the calculation:

> NNT = 1/ARR = 1 divided by 0.84% = 1/0.0084 = 119 people.

>Note how 1/119 is also less than 1%

[Anonymous No.14772000]

>>14771971
>https://www.thelancet.com/journals/laninf/article/PIIS1473-3099(22)00054-8/fulltext

Funding
US Centers for Disease Control and Prevention.

Dicrect conflict of interest.
Its interpretation.

> 4496 Deaths
> and shitton of adverse life changing events.

Also a reportingsystem ist not bragging with numbers. its about finding out whats going on.

Not :
> adverse event ok noted down
> the end

Vaccine cause event, nobody knows why, brush it over with "its just a immunisation brah"
> while subclinical clots
> inflamations
> and capillary leaks
> are ignored.
Becuae Either you die or live after a vaccine.

> Don't question why some clot to death
> Don't question why people get extremities aputated due to clotting
> its rare

Yes its rare. extremly rare.
But how does it work?
Does it accumulate?
Do some others have subclinical clotting which will increase dose by dose?
No don't ask questions.
Just take the next booster dose.
It's safe and effective.

[Anonymous No.14772039]

>>14771974
>So during a 74 days they had only 0,4% of test subjects infected in total.
>This is a insignificant number in the context of a pandamic and also a disease in which you cannot predict when it hits.
What do you base the significance on?

>If they would vaccinate people and after the 7 days of "immunization" would manually infect all them with a cultured virus, so it's 100% sure they all have exposure then ok.
Not ok, ethically. Almost half of them were older than 55, this would have killed quite a lot in the placebo group.

> are the subjects even exposed?
As much as the placebo group

>As this formula involves division, the percentage signs cancel out. 0.95 is the same as 95%
Are you for real? Wow.

>the ARR or Absolute Risk Reduction
does not matter, as you have explained, this is for a limited time frame.

>Note how 1/119 is also less than 1%
Yes, [math]\frac{1}{\frac{1}{0.008}} = 0.008[/math]. Alternatively, 1/(1/ARR) = ARR. What's your point?

[Anonymous No.14772080]

>>14772000
> and shitton of adverse life changing events.
Life changing such as Dyspnoea, Pyrexia, Fatigue, Headache, Chest pain, Nausea, Pain, Asthenia, Dizziness. I'm 32 years old and healthy and I have had all of that the last time I had the flu. Also, none of these are compared to what you'd expect in the rest of the population.

>Becuae Either you die or live after a vaccine.
That's true for literally everything. Either you die or live after fapping.

> Don't question why some clot to death
Wrong. https://www.bmj.com/content/373/bmj.n1114

> Don't question why people get extremities aputated due to clotting
Meds.

>No don't ask questions.
Wrong. Scientists asked exactly those questions and looked at the data in detail, as in the study I linked above.
Fun fact: After that, they stopped giving AZ to young women for exactly the findings in this study and others, that young women are affected more by this.

>It's safe and effective.
Unironically this.
>A higher than expected rate of cerebral venous thrombosis was observed: standardised morbidity ratio 20.25 (8.14 to 41.73); an excess of 2.5 (0.9 to 5.2) events per 100000 vaccinations. The standardised morbidity ratio for any thrombocytopenia/coagulation disorders was 1.52 (0.97 to 2.25) and for any bleeding was 1.23 (0.97 to 1.55). 15 deaths were observed in the vaccine cohort compared with 44 expected.
Is it great? No. Is it a scandal? Also, no. Are you /pol/tards renaming all vaccines because of 2.5 per 100,000 for one of the vaccines that caused most countries to stop admission after the first signs came to light? Absolutely.

[Anonymous No.14772094]

>>14772080
Oh, and since we were talking about small probabilities and significance earlier. Germany stopped after six cases of CVST were reported, even though only one was expected.

[Anonymous No.14774323]

>>14763438

https://jamanetwork.com/journals/jamacardiology/fullarticle/2791253
>SARS-CoV-2 Vaccination and Myocarditis in a Nordic Cohort Study of 23 Million Residents
>Karlstad et al
>numbers of excess events were 5.55 (95% CI, 3.70-7.39) events per 100000 vaccinees after the second dose of BNT162b2
>and 18.39 (9.05-27.72) events per 100000 vaccinees after the second dose of mRNA-1273.
>Estimates for pericarditis were similar.

https://pubmed.ncbi.nlm.nih.gov/33102537/
>Prevalence of Myocardial Fibrosis in Intensive Endurance Training Athletes: A Systematic Review and Meta-Analysis
>Zhang et al

https://jamanetwork.com/journals/jama/fullarticle/2789793
>The COVID Heart—One Year After SARS-CoV-2 Infection, Patients Have an Array of Increased Cardiovascular Risks
>Jennifer Abbasi
> the heightened risks were evident even among those who weren’t hospitalized with acute COVID-19

https://jamanetwork.com/journals/jama/fullarticle/2790421
>Myocarditis Following a Third BNT162b2 Vaccination Dose in Military Recruits in Israel
>Limor Friedensohn et al
>2 weeks following a third vaccine dose
>for males 18-24 years old only: 6.43 (95% CI, 0.13-12.73) and 11.25 (95% CI, 2.92-19.59) per 100000 vaccines

https://pubmed.ncbi.nlm.nih.gov/33360731/
>Endothelial cell damage is the central part of COVID-19 and a mouse model induced by injection of the S1 subunit of the spike protein
>Nuovo et al

https://www.sciencedirect.com/science/article/pii/S0048969721074222
>Toxicity of spike fragments SARS-CoV-2 S protein for zebrafish: A tool to study its hazardous for human health?
>VenturaFernandes et al
>Zebrafish injected with SARS-CoV-2 rSpike protein shows several morphological alterations.

[Anonymous No.14774346]

>>14774323
What are you saying? The risk of myocarditis after the vaxx is low, the infection fucks up your heart and something about fish?

[Anonymous No.14774379]

>>14774346
The risk of myocarditis after the vaxx is the highest for any vaccine ever
both the infection and the vax can fuck up your heart both related to the spike protein
probably due some mechanism related to the endothelial damage paper

[Anonymous No.14774382]

>>14774379
What about the risk reduction due to the vaccine?

[Anonymous No.14774406]

>>14764403
That's the impression I got as well. Super easy to manipulate antivaxers.

[Anonymous No.14774408]

>>14774406
>Super easy to manipulate antivaxers.
Uhhhhhhh....

[Anonymous No.14774417]

>>14774408
Ever notice how the antivaxxers who "think for themselves" all parrot the same shit?

[Anonymous No.14774431]

>>14774417
>A bunch of people come to the same conclusion independently without talking to each other.
>WHAT A BUNCH OF SHEEP!!!
>NOT LIKE US FAUCCI AND SCIENCE BELIEVERS!

[Anonymous No.14774435]

>>14774382
Anon, you're so far behind...

https://cris.tau.ac.il/en/publications/waning-of-sars-cov-2-booster-viral-load-reduction-effectiveness
>Waning of SARS-CoV-2 booster viral-load reduction effectiveness
>Matan Levine-Tiefenbrun et al
>becomes small and insignificant in the third to fourth months.

vax produces no monoclonal protection
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8185186/
>SARS-CoV-2 mRNA vaccination induces functionally diverse antibodies to NTD, RBD, and S2
>Amanat et al

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4516275
>Imperfect Vaccination Can Enhance the Transmission of Highly Virulent Pathogens, 2015
>Read et al

https://pubmed.ncbi.nlm.nih.gov/35442459/
https://jamanetwork.com/journals/jamanetworkopen/fullarticle/2791312
>Rates of COVID-19 Among Unvaccinated Adults With Prior COVID-19
>Ridgway et al

[Anonymous No.14774441]

>>14774431
That's a valid hypothesis. However, the chance that they all misinterpret things equally is really low. Take this example:
>>14771932
>Its 1 in 5000 shots causes a severe adverse event
>CAUSES
Weird, >>14773541
comes to the same conclusion. And so does >>14774012
What made their independent research come up with this number?
Ohhh, this publication that says something completely different: >>14774056
Really odd that they all made the exact same mistake in their independent research. Or maybe they didn't research but just mindlessly parroted whatever fits their narrative?

[Anonymous No.14774448]

>>14769979
>TRUST THE SCIENCE
Science isn't an authority that demands trust, prove your statements or I ignore them

[Anonymous No.14774454]

>>14774441
The 1 in 5000 number is what a Canadian health official said. Its just what they admit to so far. It used to be no side effects, remember when they said it was safe and effective? I do.
https://ottawa.citynews.ca/local-news/much-lower-than-one-in-5000-doctors-take-issue-with-dr-moores-myocarditis-claim-5588173

[Anonymous No.14774466]

>>14774454
I think you overlooked something in your independent research. You didn't even have to read half the headline. It doesn't say 1 in 5000, but
>Much lower than one-in-5000
That's literally the opposite of what you claim. It's NOT one in 5000, but it's much lower.

[Anonymous No.14774474]

>>14774466
You didnt read past the headline. The original doctor ( Dr. Moore) said "1 in 5000" the author of the article then quotes a different doctor ( Dr. Kate Hanneman) whos says its much less.

[Anonymous No.14774488]

>>14774474
So you linked a rebuttal to your claim? Are you for real? This guy said something between imprecise and wrong and you send me "here's a wall of text why he's wrong"

It's also funny how the independent researchers dismiss months of statements by health officials, going into lengthy details how corrupt they are etc, but when they say one thing that fits their narrative, there are no questions asked. Pure appeal to authority. The data disagrees with this guy? Doesn't matter, he's "Ontario's Top Doctor" so we have to believe what he's saying, right? After all, we're independently researching, not looking at data.

[Anonymous No.14774495]

>>14774488
>goal posts: moved

[Anonymous No.14774504]

>>14774495
No goalpost here. "Independent research" coming to the same conclusion by extreme cherrypicking is just ridiculous. It's not independent.

[Anonymous No.14774518]

>>14774504
>I am never wrong because I am always right

[Anonymous No.14774526]

>>14774518
So you are convinced that one in 5000 Covid vaccines causes myocarditis?

[Anonymous No.14774561]

>>14763438
This is misinformation pushed by big oil/Russia(the world's gas station) so you don't realize that all of these ailments are caused by global warming.
In a world where everyone is playing 5d chess, don't be thinking about checkers bro. The only thing that matters is how fast you save us all by getting used to eating bugs

[Anonymous No.14774633]

>>14774379
we have known about spike toxicity since late 2020
https://www.biorxiv.org/content/10.1101/2020.12.21.423721v1
>The SARS-CoV-2 spike protein disrupts the cooperative function of human cardiac pericytes - endothelial cells through CD147 receptor-mediated signalling: a potential non-infective mechanism of COVID-19 microvascular disease

vaccines were a deliberate mistake

[Anonymous No.14774692]

>>14763438
dont cry now
this is the future you chose

[Anonymous No.14774785]

>>14774406
Lol, retard

[Anonymous No.14774987]

>>14767423
people have a 1 in 7 chance of dying on a tuesday
without resorting to conspiracy theories, what are the odds of vaccine side effects increasing by that extent the same year the clotshot was released?

[Anonymous No.14775316]

>>14774431
Everybody knows what your conclusions are which is why they're so easy to exploit.

[Anonymous No.14775844]

>>14774526
Its higher. They used to say it was zero, now apparently its enough they have to admit it happens. Moving goal posts in real time.
>safe and effective

[Anonymous No.14776067]

>>14771518
Proofs?

[Anonymous No.14776098]

>>14776067
How about that when they got approval they said it was safe and now they are saying its not as safe as they said? Are their own words not enough proof?

[Anonymous No.14776139]

>>14776098
>oh no, an 1 in 50,000 effect wasn't discovered in a study where they vaccinated 20,000 people

[Anonymous No.14776147]

>>14776139
it's not a vaccine though

[Anonymous No.14776150]

>>14776139
Yes. Thats a weird way to admit you are wrong.
>1 in 50,000
Why throw in a lie though? There were already articles that quote government officials saying much higher rates of serious side effects, and that doesn't even include less serious side effects.

[Anonymous No.14776153]

>>14776147
Trolling outside of /b/ is against the global rules.

[Anonymous No.14776154]

>>14776139
Myocarditis rates now at 1-2% of teen boys.

[Anonymous No.14776155]

>>14776139
>Admitting they didn't sufficiently test a new "vaccine"

[Anonymous No.14776157]

>>14776153
>if I don't like what you say its trolling!!!

[Anonymous No.14776160]

>>14776150
>Why throw in a lie though?
Not a lie. Sauce:
nature . com / articles / d41586 -021-02 740-y (why does 4channel hate nature links?)

[Anonymous No.14776162]

>>14763596
>>14764636
>>14764846
>>14765166
>>14765183
>>14767236
>>14767427
>>14767681
>>14767701
>>14768349
>>14769979
>>14771518
>>14771585
>>14771701
>>14771819
>>14771835
>>14771932
>>14771954
>>14771974
>>14772000
>>14774323
>>14774379
>>14774408
>>14774431
>>14774435
>>14774454
>>14774495
>>14774518
>>14774633
>>14774692
>>14775844
Please go back to /pol/

[Anonymous No.14776163]

>>14776154
That is a lie.

[Anonymous No.14776166]

>>14776160
>1 in 5000
Two links already in this thread quoting from government sources. Just stop lying. Nobody is forcing you to be wrong except yourself.
https://www.israelnationalnews.com/news/356900
https://ottawa.citynews.ca/local-news/much-lower-than-one-in-5000-doctors-take-issue-with-dr-moores-myocarditis-claim-5588173

[Anonymous No.14776172]

>>14776166
>news/much-lower-than-one-in-5000-d
>Zionist online News
This was already completely dissected, you fucking retard. Read the replies. Read the original study from Germany, paste the shit in deepl if you're a monolingual redneck

[Anonymous No.14776182]

>>14776172
>doesnt even read past the headline
The article is quoting 2 different doctors
>“We know there is a risk, a very small risk, one-in-5000, that someone may get myocarditis,” answered Dr. Moore at Wednesday’s news conference.
Why the FUCK do you LIE so much? You fucking disgusting vile liar. You literally don't read fucking anything, you just lie and make shit up. Fuck you, dumb shit.

[Anonymous No.14776185]

>>14776182
Why the fuck do you repeat the bloody lie about the German study?
Also, the Canadian guy didn't talk about a general risk, but for a specific subset of age and gender.

[Anonymous No.14776193]

>>14776162
Fuck off

[Anonymous No.14776194]

>>14776185
>moving goal posts
Fuck. Off. We are way past "safe and effective" like they used to say. Its like trying to argue you didn't kill them with a knife you killed them with a dagger. Dumb fuck lying shill.

[Anonymous No.14776197]

>>14776194
No, tell me. You complain about liars and post the same lie not once, but twice in the same thread. Even after you were hand-fed the original data.

[Anonymous No.14776202]

Don't know why are you discussing when there's a source here in this thread

https://jamanetwork.com/journals/jamacardiology/fullarticle/2791253
>SARS-CoV-2 Vaccination and Myocarditis in a Nordic Cohort Study of 23 Million Residents
>Karlstad et al
>numbers of excess events were 5.55 (95% CI, 3.70-7.39) events per 100000 vaccinees after the second dose of BNT162b2
>and 18.39 (9.05-27.72) events per 100000 vaccinees after the second dose of mRNA-1273.
>Estimates for pericarditis were similar.
18.39 (9.05-27.72) events per 100000 vaccinees after the second dose of mRNA-1273
18.39 (9.05-27.72) events per 100000 vaccinees after the second dose of mRNA-1273
18.39 (9.05-27.72) events per 100000 vaccinees after the second dose of mRNA-1273
18.39 (9.05-27.72) events per 100000 vaccinees after the second dose of mRNA-1273

[Anonymous No.14776212]

>>14776202
>young males aged 16 to 24 years
>young males aged 16 to 24 years
>young males aged 16 to 24 years
>young males aged 16 to 24 years

[Anonymous No.14776215]

>>14776212
Yes, I know
What's your point?

[Anonymous No.14776219]

>>14776215
How could they mathematical detect this in a study with 44,000 people? Half of them get the placebo anyway.

[Anonymous No.14776221]

>>14771522
Sweden had an age-based lockdown and people agreed with it because they understand that protecting the elderly is a good cause.

[Anonymous No.14776223]

>>14776215
His point is that the vaccine is safe an effective. Clearly. Just take it. Its free. Or else.

[Anonymous No.14776227]

>>14771564
>Why are the unvaccinated responsible for 65.4% of the deaths if they only make up 11.6% of the population?
Because the CDC considers people with 1 vaccine pre-boosters, 2 vaccines and no booster after boosters were mandated, or 14 days out from last booster as unvaccinated.

[Anonymous No.14776229]

>>14776219
>Study of 23 Million Residents

Sorry we injected you with a heart scarring formula kid but hey, we have won billions of dollars, so no problem here..

[Anonymous No.14776233]

>>14776227
They're still 11.6% only.

[Anonymous No.14776234]

>>14776227
>get the vax for your "protection"
>die within 14 days
>"Another sad death to COVID! If only more people got boosted!"

[Anonymous No.14776235]

>>14776229
Before vaccinating 23 million people:
>Can't see it
After vaccinating 23 million people
>Hurrdurr shouldn't have done it

Choose one, faggot.

[Anonymous No.14776238]

>>14776233
People who are totally vax-free currently, yes, but deaths from people who count as vaxed in official stats are ruled as unvaxed on their death report according to CDC guidelines. It's done to manipulate the statistics.

[Anonymous No.14776239]

>>14776235
Primum non nocere

[Anonymous No.14776246]

>>14776239
Well done, I'm sure you will graduate 6th grade with those Latin skills.

[Anonymous No.14776251]

>>14776238
It's the same statistic. 11.6% are responsible for 65.4%. There's no room for interpretation.

[Anonymous No.14776253]

Albert Boula
Stephane Bancel
Noubar Afeyan
Robert S Langer

[Anonymous No.14776257]

>>14776251
>Only my interpretation is correct. The science is settled!

[Anonymous No.14776262]

>>14776257
It's the same table and none of what you wrote is in the caption or text.

[Anonymous No.14776273]

>>14776262
>you wrote
I know its hard to imagine there are actually multiple people in this thread when there are so many in your own head.

[Anonymous No.14776282]

>>14776139
I don't understand this post. Your example is literally why VAERS should exist and its data is worth considering

[Anonymous No.14776287]

>>14776282
Anything that might suggest my product is faulty should be banned.

[Anonymous No.14776288]

>>14776287
>all my friends are strawmen

[Anonymous No.14776353]

>>14776287
Interesting quote. Quite true. Wonder if that guy wrote more on that subject?

[Anonymous No.14776379]

>>14771522
No one is even reading your soi babble.
You've been at this for over 24 hours now.
Your posting is not natural and follows the same format everytime.
This is the part where you shout /pol/ or skitzo

[Anonymous No.14776396]

>>14771733
You don't think it's strange that the virus derped it's spike protien right after the vaccine push?
A vaccine that specifically targeted that protien.

[Anonymous No.14776398]

>>14776379
bots.
Twitter is proven to be like 60% AI bots now.
Stands to reason most pro-gov/pro-pharma posts are bots as well.

[Anonymous No.14776403]

>>14776398
If Twitter is 60% bots then how is 4chan not 80% to 90% bots by now?

[Anonymous No.14776410]

>>14776403
I'm schizophrenic and it messes up their machine learning programs.

[Anonymous No.14776411]

>>14776396
Just like how COVID started causing myocarditis after the vaccine was released! Crazy! Who knew??

[Anonymous No.14776412]

>>14763438
Obsessed with vaccines still... fucking hell.

[Anonymous No.14776417]

>>14776411
COVID was always known to cause myocarditis

[Anonymous No.14776418]

>>14776412
>Get. The. Vax. Its safe and effective. Its free. Are you scared of needles? Everyone is doing it. Youre a murderer if you dojn't get it. There is no evidence its harmful, and even if it is the risk is small and worth it to save lives. Trust Fuacci. Believe science. Get it or else you can't travel or have a job and we might lock you up in a camp. For your own health by the way.

[Anonymous No.14776424]

>>14776412
This. Sad to see that most of /sci/ doesn't even know what a vaccine is. The covid vaccines are doing their job and yes, are vaccines; they were never meant to give complete immunity to viruses. That's why when my daughter catches measles from her classmates every year, I'm thankful that her symptoms are mild - without that shot she probably wouldn't be here today.

[Anonymous No.14776426]

>>14776417
>We were always at war with Eastasia

[Anonymous No.14776446]

>>14776412
Most American universities are still requiring students and new hires to get the vax

[Anonymous No.14776468]

>>14776446
>American universities
lmao

[Anonymous No.14776472]

>>14776424
>without that shot she probably wouldn't be here today.
mmmmmmmmm smells like cope

[Anonymous No.14776480]

>>14776472
Her death would have been painful without the vax.

[Anonymous No.14776485]

okay, but why even bother with studies of dubious origin, the original whitepaper for seeking FDA approval for EUA had all cause mortality higher in the v group than in the uv group.

Remember that is with all of the experimental bias... there is still a negative signal.

Straight from the horses mouth

[Anonymous No.14776515]

>>14776485
What part of safe an effective is hard for you /pol/chud incels to understand???? The science is settled. Just get the vax.

[Anonymous No.14776536]

>>14776424
>That's why when my daughter catches measles from her classmates every year, I'm thankful that her symptoms are mild - without that shot she probably wouldn't be here today.
Kek.

[Anonymous No.14776552]

>>14776480
>Her death would have been painful without the vax.
kek good one.

[Anonymous No.14776769]

>>14776536
>>14776552
Dude fuck off

[Anonymous No.14776773]

>>14776769
no u

[Anonymous No.14776782]

>>14776773
I deliberately didn't want /pol/ shit in my thread. Please. Fuck. Off.

[Anonymous No.14776783]

>>14776782
>my thread
Just like you didn’t want the fact the vivid injection is not safe and effective to enter your brain?

[Anonymous No.14776787]

>>14763438
Concentrated populations? I can't imagine most Israelites living far from the main cities given the desert biome.

[Anonymous No.14776802]

>>14767681
>>14771518
Most of the stocks for those companies trying to feed off the Rona hype were pump and dump schemes. If billions of dollars are shuffled into someone's pockets, sure, that's a con. But the economic hype was going with respect to vaccine distribution died a miserable death -- implying there's no correlation between big pharma and the vaccines.

The real reason there's a hype scare over these things is the scientists behind the models are probably being pressured by their upper like bosses and project managers to provide a solid answer the data can't provide. Model says "virus is deadly with 70% confidence," what then? It's probably better to say it's deadly and handle the fallout of it not being deadly than saying it's not and lose millions. The vaccines are meant to handle the worst cases.

[Anonymous No.14776815]

>>14776802
the clotshot isn't a vaccine

[Anonymous No.14776823]

>>14776815
You don't even know what a vaccine is, tourist. Please, just fuck off

[Anonymous No.14776826]

Remember when vaccines used to provide immunity and not """protection""". Yeah me too.

[Anonymous No.14776829]

>>14776823
well it's tough when you keep changing the definition in order to shill your latest failed theraputic

[Anonymous No.14776842]

>>14776829
>oh no, they changed a word!

[Anonymous No.14776848]

>>14776842
Immunity and immune response are not the same thing.

[Anonymous No.14776874]

>>14776842
>intentional dishonesty
Why?

[Anonymous No.14776893]

>>14776848
Why not?

[Anonymous No.14776901]

>>14776893
If you start sneezing from pollen, you're experiencing an immune response. You haven't developed immunity to it. Lupus is a result of a jacked up immune response. An immune response doesn't equal immunity.

[Anonymous No.14776930]

I never got vaxed (because I'm a shut-in not because of conspiracies) and my roommate who did get vaxed ended up with mild covid. I either never caught it from him or was asymptomatic the whole time because it's been a couple months now and i'm fine. My Mom on the other hand (also vaxed) got pretty fucked up by it and can barely walk up stairs without wheezing

[Anonymous No.14776977]

>>14776829
You /pol/tards are like the ancient Greeks who never checked if there were really gods at the top of this mountain. I mean, they literally just needed to walk up to know that it's all bullshit. It took me under a minute to show that your image is a lie.

https://web.archive.org/web/20200516104515/https://www.merriam-webster.com/dictionary/vaccine

[Anonymous No.14776980]

>>14776901
But a stimulated immune response against an infectious disease leads to an artificially increased immunity.

[Anonymous No.14777018]

>>14776977
So you proved his image is correct? I am legitimately confused what you are trying to say because your image and link are the same as his, they did change the definition of a vaccine?

[Anonymous No.14777026]

>>14777018
I don't know what culture you live in, but in western culture, May comes after April. Assuming you're a Jew who lies about this: You claimed that the dictionary read the second text after Nissan 5780. However, I presented that on Iyar 15, 5780, the dictionary has not yet changed, making you a dirty liar. Do you understand it now?

[Anonymous No.14777030]

>>14777026
Wait, you're complaining that the date is wrong, not that they changed the definition?

[Anonymous No.14777036]

>>14777030
Every conspiracy theorist's lie needs a grain of truth, otherwise no one would believe them anymore. But that grain of truth is then embedded in a lie that fits the narrative. "They" (whoever they is, Mr. Pfizer? Mr. Merriam and Mr. Webster? The government (so, Trump at that time?) changed the definition in April 2020, the month after the first lockdowns were imposed in western countries. Spooky coincidence or a clear proof that it's all part of an evil master plan? Neither, just a grain of truth served together with a lie.

[Anonymous No.14777068]

>>14771940
>Would you want them to sit on their data for years in the middle of a pandemic?
Exactly. If you want to take measures you have to evaluate cost and reward, and the costs of taking the vaccine and obeying the lockdowns were unknown because to conclude, beyond any reasonable doubt, that the vaccine immunity could last a year or so for example, was waiting a year and do the checks. Same if you want to know the possible side effects. The trials exists for a reason, anon. See Trastuzumab causing cardiac diseases years after its application without people knowing this. But everyone was so driven by emotion that they rushed everything and now we have increasing global hunger and recession, and vaccine doses whose side effects are still unknown and sometimes heavily linked to heart diseases, and let alone that covid deaths haven't stopped and the majority of ER cases are comprised of vaccinated people. But hey, at least we are saving lives, amirite?

[Anonymous No.14777070]

>>14777068
>But hey, at least we are saving lives, amirite?
What's the ratio of lives saved and lives lost due to the vaccine?

[Anonymous No.14777087]

>>14777036
Ok, but why did they change the definition at all? The conspiracy isn't the date, its the change in definition.

[Anonymous No.14777088]

[Anonymous No.14777089]

>>14777070
First, we roughly had 2 years of vaccinations, and many side effects could not appear until much later, there's no way of knowing until enough time has elapsed (which usually is like 5 years), which is the reason why the trials exists in the first place. Again, trastuzumab for an example.
And second, you are missing the bigger picture. How many people die of hunger each year? How many have died of hunger since the beginning of lockdowns and disruption of the supply chain? How many people are living in poverty right now in comparison to the beginning of the lockdowns? This little adventure of you people, driven by emotion and an irrational cult to science, is what brought the decay you see now. You people prefer to "save" <10 million potential victims from a disease with 99.8% survival rate, while condemning +100 millions to adverse conditions that might kill them for sure? As I'm aware, no one has survived extreme hunger. If you don't eat, you die, simple as.

[Anonymous No.14777098]

>>14777087
"They" changed the "definition" because it was not even complete in 2019, as it doesn't include protein-based vaccines. You cut off most of the current version, it's several times longer than 2 years ago. If you compare them, you'll find that today's version is more general, more complete and incorporates the latest developments in the field, including vector and mRNA based vaccines. There are also DNA vaccines which have reached phase III trials, and also fall under the new description.

[Anonymous No.14777106]

>>14777089
>many side effects could not appear until much later
Hasn't ever happened with vaccines, not before mRNA and so far not with mRNA. Never say never, but what's the consequence? Vaccinate 20,000 people, wait 30 years and then consider the vaccine safe and start vaccinating?
>you are missing the bigger picture
I'm well aware. How many people die of the war in Ukraine because they starve or freeze to death? China doesn't care if Africans starve because of broken supply chains and neither does Russia. What could I do about it?
>This little adventure of you people
Who's "you people"? I didn't do anything. I'm not a policy maker. I can't do anything about world hunger either. You're barking at the wrong tree.

[Anonymous No.14777112]

>>14777087
>"The definition (of) immune response provides a detailed description of how a vaccine actually works and is therefore more specific, scientific and complete than the more general term immunity," Sokolowski said.
You can literally find out why they did it if you Google it.
https://eu.usatoday.com/story/news/factcheck/2021/11/30/fact-check-merriam-webster-changed-vaccine-definition-accuracy/6354415001/

[Anonymous No.14777120]

>>14777112
>fact checkers
Is there any more blatant title for Orwelian double speak?

[Anonymous No.14777123]

>>14777120
Ignore the stupid term and consider it an interview with the editor at Merrim-Webster asking him why they changed the definition if you will.

[Anonymous No.14777204]

>>14776773
does anyone have the cum edit of this

[Anonymous No.14777213]

>>14776773
I love the labels. You don't need to think one bit. And he doesn't need to be a good artist since all people have their names written on them. Doesn't matter if the two don't look like gates and fauci.

[Anonymous No.14777242]

>>14777123
>Ignore that the ministry of truth published this

Nah, probably not going to ignore that bro

[Anonymous No.14777243]

>>14777242
>USA today is the government

[Anonymous No.14777246]

>>14763719

[Anonymous No.14777250]

>>14777243
>Multiple organisations publishing "the truth" for every single thing in lockstep is just a happy coincidence

Ok

[Anonymous No.14777254]

>>14777250
It's just an interview with the editor, take it or leave it. You could have the exact same answers in a blogpost on merriam-webster.com without the cringeworthy "fact checkers" theme, would you believe it more then?

[Anonymous No.14777255]

>>14777254
>Would you believe our propaganda if we framed it differently

Nah probably not cunt. You feel free to sign up for the Pfizer lifetime subscription though, a solid and reputable company.

[Anonymous No.14777260]

>>14777255
>Editor of MW does something
*pointing soijaks*
>Editor of MW explains why he did it
HURRDURR MUH GOVERNMENT

[Anonymous No.14777276]

>>14777089
Just like we cant tell the consequences of the vaccine we also can't tell the consequences from having the virus. Remember that the virus has mRNA and spike proteins too.
Vaccines were a good thing and thank god we stopped the original covid variant. I assume you remember thousands of dead in Italy including young(er) people in their 50's. Dying not only from viral pneumonia but from arterial and venous thrombosis, heart complications. It was a dangerous virus with high mortality (and morbidity) fully capable of breaking the healthcare systems of countries.
Also you imply this
>See the virus wasn't so deadly only 10 mio people wtf
We had lockdowns and vaccines, that's what kept the numbers low, the actions you criticize without offering a good alternative.
>a disease with 99.8% survival rate
Incorrect. The original virus had a death rate of closer to 3%. Among 50 yo it was 0.5%.
0.5% is a very high death rate for a medical condition. Most surgeries don't come anywhere near that number. Invasive interventions like angiograms have a 0.01% risk of causing stroke. You get the point?
Even if a person survives if they need oxygen or ICU it's still a big problem.

Current strains are mild, thankfully. That's why there's no lockdowns or masks anymore. And the vaccines are elective at this point and they don't even work on the new strains.
But they served their purpose at the time.

[Anonymous No.14777284]

>>14777276
>thank god we stopped the original covid variant.
What god?
We? Who is we?
And you make it look like stopping was an active process and not something that just happened. What makes you so sure it stopped because of us?
Also what makes you think it was the original variant? How do you know that there wasn't one before?

Btw the Italy coffin army trucks pics were just wrongly interpreted because funerals had been stopped.

[Anonymous No.14777290]

>>14777276
>The original virus had a death rate of closer to 3%
No. People THOUGHT it had that. But very soon it came out it hadnt. Overestimated.

[Anonymous No.14777304]

>>14777284
agreed, we should've done nothing
>>14777290
the clotjab vaxx is deadlier than covid

[Anonymous No.14777314]

>>14777304
>the clotjab vaxx is deadlier than covid
>source: trust me bro

[Anonymous No.14777315]

>>14777290
everyone over at pol knew it was a nothingburger as soon ass everyone else took it seriously but before that it was a huge threat noone was taking seriously it was le coronachan (like ebolachan) lmao

[Anonymous No.14777318]

>>14777284
>What god?
Are you this autistic?
>Used to express gratitude or relief.
In this case relief. Inb4 still too autistic
>The feeling associated with the removal of stress or discomfort.

[Anonymous No.14777319]

>>14777314
two more years

[Anonymous No.14777322]

>>14777315
Everyone at pol screeched to close the borders in January and February, but as soon as people took it seriously, they shifted 180° and called it a nothingburger.
Do you remember the drone videos of the crematorium queue in Wuhan?
>they downplay the death numbers
>it's much more dangerous than the CCP admits
>that doctor who blew the whistle died

/pol/ has no added value over the mainstream consent, since it's just the inverse of whatever is mainstream. It can be replaced with an XOR and whatever the government does. Government: Russia bad, /pol/: Russia good. Government: wear masks, take the jab, /pol/: don't wear masks, don't take the jab. Government: the vaccine is a vaccine, safe and effective. /pol/: it's not a vaccine, it's not safe and it's not effective
Not just here, but in all ranges. Government: we need to emit less CO2 because that heats the planet. /pol/: emitting CO2 doesn't heat the planet and we don't need to emit less of it.

If /pol/ were a C++ function, the compiler would optimise it away and replace it with a "not"

[Anonymous No.14777324]

>>14777319
Can't wait to finally die from my shots.

[Anonymous No.14777325]

>>14763438
>Israel gets spikes?"
learn the difference between alpha, delta & omicron
https://en.wikipedia.org/wiki/Basic_reproduction_number#Sample_values_for_various_infectious_diseases

[Anonymous No.14777328]

>>14777325
>9.5-21[32]
We're at measles and chickenpox levels? Wow. And the common cold only has an R0 of 2-3? I always had the impression of someone came to work with a cold, half the office also has it a couple days later.
And that's just the average number, for every NEET who infects no one, there are people who infect more than average.

[Anonymous No.14777344]

>>14777322
Faggot.

[Anonymous No.14777353]

>>14777344
You kept this beautiful collage for 1.5 years in your /4chan/pol/coronavirus/ directory just to impress us? How cute.

[Anonymous No.14777360]

>>14777344
this image you posted just proves the anon you responded to correct you mindless drone you

[Anonymous No.14777386]

>>14771874
Well done for outing yourself smooth brain. I’m not even that anon but I’ll ask for him again: what did they define vaccinated as? Double jabbed? Triple jabbed? Quadruple jabbed?
Now think about why that definition matters over the wide sampling time period before you sperg out again

[Anonymous No.14777388]

>>14777353
>implying I keep my phone that organized

[Anonymous No.14777394]

>>14777386
Read the article yourself, faggot. I could be telling you anything. I could tell you that they only consider 6 times jabbed for at least 4 months as fully vaccinated, or the day after the first jab. Why would you trust me with any of this?

[Anonymous No.14777533]

>>14777394
How did they calculate the proportion of population vaccinated and unvaccinated? WAIIS? Note the section on page 18 stating that anyone on WDRS with missing vaccination information was automatically classed as unvaxxed. How many ended up falling in this category?
Why are they still defining hospitalisations as anyone hospitalised WITH covid as opposed to DUE TO? (they do not explicitly state exactly which definition they use)
Why, 2 years on into the pandemic, does the report not stratify between primary series and boosters?

These are serious questions that need to be answered

[Anonymous No.14777787]

>>14777533
>anyone on WDRS with missing vaccination information was automatically classed as unvaxxed. How many ended up falling in this category?
So the 11% is an overestimation? In reality, the unvaccinated are even more overrepresented? :3
>Why are they still defining hospitalisations as anyone hospitalised WITH covid as opposed to DUE TO? (they do not explicitly state exactly which definition they use)
Does it matter in this case? If everyone was hospitalised WITH Covid, wouldn't the percentages pretty much be the part of the population? Meaning, 11% of the population are unvaccinated -> 11% of the hospitalised who randomly have Covid are unvaccinated.
>Why, 2 years on into the pandemic, does the report not stratify between primary series and boosters?
doesn't matter for the point that the unvaccinated are heavily overrepresented. No matter how you distribute the 40% of hospitalisations/deaths among the 1, 2, 3, 4, 5 times vaccinated. ~11% of the population are responsible for ~60% of the most severe outcomes.

>These are serious questions that need to be answered
that's called muddying the waters. None of your points have to do with this question. Well, one potentially, but any answer would make the unvaccinated look even worse.

[Anonymous No.14777823]

>>14777106
>Hasn't ever happened with vaccines, not before mRNA and so far not with mRNA.
Ignoring history is a deadly mistake. There wouldn't be any doubt if the trials ended as they should instead of rushing it because of emotional response.
>What could I do about it?
Perhaps showing opposition to policies that worsen people's quality of life in the name of the "greater good". The road to hell is paved with good intentions.
>I didn't do anything.
I can see that.

[Anonymous No.14777833]

>>14777823
History: long-term side effects appear within weeks of the vaccine
>Ignoring history is a deadly mistake
>Perhaps showing opposition to policies that worsen people's quality of life in the name of the "greater good". The road to hell is paved with good intentions.
The only policy in effect is that you can get a free test. There's no other policy I could show opposition to.

[Anonymous No.14777874]

>>14777276
>we also can't tell the consequences from having the virus.
And yet countries established many measures by going with the "science is settled" thing. I don't know how you can conciliate two different realities: One which science and our understanding of infection vectors for covid and immunity are evolving and painting a different picture when time passes, and another which science is so definitive and unquestionable that we know exactly who can't work or get out of their homes, and how long can the vaccine immunity last, with absolute precision without leaving any room for doubt. I don't really see it.
>We had lockdowns and vaccines, that's what kept the numbers low
Except it didn't happened, including now. Not long ago many criticized the late reaction of countries like Rumania or UK, to later find out that other countries had it worst than those two.
The alternative to mindless science fanatism was basic social distantiation, without totalitarian controls, and let the vaccine triald ends as planned. This is not the first pandemic in history, we know already how the story goes from beginning to end. Many famous vaccines, like vaccines for smallpox, were introduced many years after the first outbreak, and why? Because we don't know if the medicine could be worse, that's what the trials are for. Current strains are mild because, again, we know how the story goes. The first deadly strain often dies with the people who kills, leaving room for mutations who can survive, but can also be less lethal. There, knowledge that has more than a century, and yet we treat covid mutations as a marvel.
>And the vaccines are elective at this point and they don't even work on the new strains.
Except you still need to be vaccinated to travel and work on many places, this has nothing to do with science and more to do with science fanatism and totalitarism. This ain't over, states got very pleased with civil response on giving absolute powers to the state.

[Anonymous No.14777891]

>>14777833
>History: long-term side effects appear within weeks of the vaccine
Not always the case because, again, many side effects could appear years later. Wouldn't be the first time.
>The only policy in effect is that you can get a free test. There's no other policy I could show opposition to.
Really? What about travel prohibitions? Or not being able to work without the experimental shot? Or locking up sane people in their homes while the supply chain gets screwed, causing global hunger to increase for the first time since WW2? You have no problem with all that?

[Anonymous No.14777907]

>>14777322
The part you seem to be ignoring is that /pol/ was correct 100% of the time about all of this, and the establishment was 100% wrong about all of this.
The moral of the story is to always do the opposite of what your television tells you.

[Anonymous No.14777910]

>>14777874
>Not long ago many criticized the late reaction of countries like Rumania or UK
How dare they?

[Anonymous No.14777922]

>>14777910
fake numbers

[Anonymous No.14777923]

>>14777907
Yeah who doesn't remember the yellow "unvaccinated" star, or the spike proteins that the vaccinated shed? Also, I'm yet again waiting 2 more weeks for the vaccinated to drop dead.

[Anonymous No.14777924]

>>14777922
Prove it

[Anonymous No.14777932]

>>14777923
>Yeah who doesn't remember the yellow "unvaccinated" star
Yeah, I remember how "covid passes" were a "crazy conspiracy that would never happen", until they came out, and anyone who refused to get one was a "crazy conspiracy theorist", thanks for proving my point further you retarded faggot, now turn off MSNBC and get your retarded ass to /pol/.

[Anonymous No.14777937]

>>14777932
When were the passes predicted before they became reality?

[Anonymous No.14777941]

>>14777924
All data about covid is fake.
>>14777937
On /pol/, and anyone who was paying else who was paying attention. And since omicron ruined that grift, they're going to try the same thing again with "climate change".

[Anonymous No.14777944]

>le poltards!!!!

Your 'vaccine' is useless.
Your virus is a nothingburger for anyone healthy.
You're a bootlicker, and don't actually follow the scientific process.

[Anonymous No.14777964]

>>14776823
This. I caught polio a few times after getting my shot and thankfully the symptoms were minimal. Never was meant to stop the transmission, but I don't know why /pol/tards think otherwise. I might have been exposed to it again from a coworker last week, so I'm getting ready for some symptoms to show up.

[Anonymous No.14777970]

>>14777964
That explains a lot.

[Anonymous No.14777976]

>>14777944
>I follow the scientific process
the only process you follow is believing the exact opposite of anything perceived as mainstream

[Anonymous No.14777986]

>>14777976
>the only process you follow is believing the exact opposite of anything perceived as mainstream
it's a great lifehack to be correct 100% of the time

[Jealous No.14778044]

Do they inject me with poison when I find clean food and water?

[Anonymous No.14778054]

>>14777910
>Peru not on the list
Ok, ignoring that. Now show the case-fatality for those countries, you will see is very low in comparison to the "heroes who took action early", like Canada

[Anonymous No.14778055]

>>14778054
stop asking questions

[Anonymous No.14778181]

>>14777941
>All data about covid is fake
How convenient. Die please

[Anonymous No.14778199]

>>14778181
It's actually highly inconvenient to anyone interested in the truth to intentionally use faulty tests and redefine what counts as a "covid death" multiple times in the course of two years.

[Anonymous No.14778473]

>>14777322
>Video of people dying in the streets in China from mysterious potentially weaponized virus leaked from a lab
>>THIS IS SERIOUS
>people get it in US and EU, turns out its just a cold/flu and only kills old or fat people
>>Turns out it was a nothing burger
>Governments try to control peoples lives and force a hastily created drug injection on people and spend millions fear mongering and attacking "anti" vaxxers
>>LITERALLY TYRANNY
>The science has changed, were sorry (not sorry), its still safe and effective. Please keep trusting the science.
>>WE REMEMBER YOUR EVIL ACTS

[Anonymous No.14778524]

>>14777924
Isnt the burden of proof on the people who made the graph?

[Anonymous No.14778531]

>>14777923
>yellow "unvaccinated" star
Pretending that unvaccinated werent villainized and actively discriminated against is just plain lying. There were news pieces about trying to lock them up, people were fired from their jobs. It was completely immoral discrimination against people with zero basis for it.

[Anonymous No.14780051]

>>14776223
Or else take a PCR test.

[Anonymous No.14780059]

>>14780051
>not free, not covered by insurance, unless testing to confirm covid if you have symptoms
>completely booked or unavailable in your area if you dont have symptoms
>only works for 72 hours but takes 24-48 hours to process
>not always accepted for jobs, or you have to take it every day
Its not discrimination if we provide an alternative no matter how unreasonably difficult we make it :)

[Anonymous No.14780145]

>>14777276
>Incorrect. The original virus had a death rate of closer to 3%. Among 50 yo it was 0.5%.

All basd on the Premise, that the patietns:
> A: died from covid and not just positive PCR result, and died with a PCR positive test result
> B: with a test which cannot do a diffierntial diagnosis
> C: with a test that checks for unspecific proteins
> D: or no test at all since the protocolls allow declaration of covid just because the patient was close to someone who also tested positive

The fundamental premise is so fragile and "massagable" to fulfill a bias, and even though they did everything they could to declare as many people as possible as covid cases, they still could establish a miniscule mortality rate.
Please tell me in which universe this premise is somehow scientific.
Its 90% based on assumptions.
Do you even know which primers they use for PCR?

Check out the encodings of the proteins
> picrel
This is a Primerlist of the PCR-Test:

Source of PCR gene List : https://www.rki.de/DE/Content/InfAZ/N/Neuartiges_Coronavirus/DESH/Hilfestellung_PCR-Testung.html;jsessionid=4425A5530E93E28A2FA785485FEC1987.internet062?nn=2444038
DL link: https://www.rki.de/DE/Content/InfAZ/N/Neuartiges_Coronavirus/DESH/Tabelle_VOC-PCR-Finder.xlsx?__blob=publicationFile

Manino acid mutations:
>S371L & S373
> are for example proteins found in the regular flu
https://journals.asm.org/doi/10.1128/JVI.01588-17

Please elaborate on the accuracy and specificity of PCR-results.
And please answer the question:
> is the PCR-result a diagnosis?

[Anonymous No.14780240]

>>14780059
Here you could always get tested for free to get the national certificate. For the international, to travel, you needed to pay, but I don't really see why the government should subsidise you for fulfilling other countries' regulations so you can spend money there.

[Anonymous No.14780246]

>>14780145
>>S371L & S373
> are for example proteins found in the regular flu
>https://journals.asm.org/doi/10.1128/JVI.01588-17

>Please elaborate on the accuracy and specificity of PCR-results.
I don't know if that's even true, but I can't imagine PCR test kits that only contain primers for proteins found in other viruses, especially ones with such similar symptoms.

[Anonymous No.14780250]

>>14778054
if they didn't die of case fatality what did they die of?

[Anonymous No.14780258]

>>14780246
These encodings, are just encodings for certain amino acids.

Those mutation of amino acids are used as indicator for covid.

But they are not specific to covid.
Let me give you more examples, where these coded amino acid mutaions happen:
A67V :
> Somatic MED12 mutations in uterine leiomyosarcoma and colorectal cancer
https://cancer.sanger.ac.uk/cosmic/mutation/overview?id=113647641


G339D :
> Glycogen storage disease type Ib (GSD-Ib) is caused by a deficiency in the glucose-6-phosphate transporter
https://pubmed.ncbi.nlm.nih.gov/12444104/


S373P :
> DNA double strand breaks (DSBs) are cytotoxic lesions that must be accurately repaired to maintain genome stability.
> In this study, we refer to rfa1-t33 by the amino acid substitution (S373P) to use consistent nomenclatur
https://www.ncbi.nlm.nih.gov/labs/pmc/articles/PMC5218512/#R47

More suspicious genes/ "mutations" picked up by the test

S375F :
> Whole-genome analysis informs breast cancer response to aromatase inhibition.
a kinase domain mutation was identified in RPS6KB1 (S375F)
https://www.nature.com/articles/nature11143

K417N :
> Fucking yeast...
https://www.ncbi.nlm.nih.gov/labs/pmc/articles/PMC5883321/
N440K :
> A novel N440K sodium channel mutation causes myotonia with exercise-induced weakness - exclusion of CLCN1 exon deletion/duplication by MLPA
https://www.ncbi.nlm.nih.gov/labs/pmc/articles/PMC3235863/

Those mutations can be found in hundreds of places and diseases.

[Anonymous No.14780260]

>>14776287
is inferiority really just a left thing, I feel like anyone could end up with feeling like that just from daily life

[Anonymous No.14780263]

>>14776782
you don't have a single fact to argue why it would be more or less painfull

[Anonymous No.14780264]

>>14776842
he says using words

[Anonymous No.14780265]

>>14777088
that's a lot of golems

[Anonymous No.14780267]

>>14777088
that's a lot of golems

[Anonymqus No.14780270]

>>14780145
I don't want to take the test, it seems spiked (heh) with stuff that will make you sick

[Anonymous No.14780271]

>>14780059
You make yourself unreasonably difficult for everyone else so I see no issue with that.

[Anonymous No.14780278]

>>14780271
>it's moral, rational and necessary to use violence against me
Oh, okay.

[Anonymous No.14780280]

>>14780258
In case you're not trolling: Do you know what these things mean that you quote?
>K417N
It means that at position 417 the amino acid Lysine is replaced by Asparagine (in this case in the spike protein).
>https://www.ncbi.nlm.nih.gov/labs/pmc/articles/PMC5883321/
Here, the same happened in the Meiosis protein MEI2 whatever that does in detail.

Do you think that every protein that has Asparagine in position 417 is identified as the spike protein? Especially since you don't have any idea that it was supposed to be Lysine when you just have one specimen.

[Anonymous No.14780298]

>>14780280
> Do you think

No that is explicitly how a PCR test works.

Reverse transcription polymerase chain reaction (RT-PCR) is a laboratory technique combining reverse transcription of RNA into DNA (in this context called complementary DNA or cDNA) and amplification of specific DNA targets using polymerase chain reaction (PCR).

You give it primers, which have a code and encode a specific, tiny segments of a protein/amino acid.

You stirr up the sample, fragmanting it.
Then you amplify it with the PCR method, and find the selected primers.
It can only find whats in the primers.
From the primers only 2 targets have to match.

https://www.who.int/news/item/26-11-2021-classification-of-omicron-(b.1.1.529)-sars-cov-2-variant-of-concern

"Current SARS-CoV-2 PCR diagnostics continue to detect this variant. Several labs have indicated that for one widely used PCR test, one of the three target genes is not detected (called S gene dropout or S gene target failure) and this test can therefore be used as marker for this variant, pending sequencing confirmation"
> picrel
Meaning, that they will now make the PCR-Tests more sensitive.
Tests that were negative before because only 2 primers where positive and not three, are now positive.
We take the negatives and turn them positive.
You understand?

They adjust the primers for each variant, and say "now use three then four then two" whatever.
The protocoll creates the cases.

[Anonymous No.14780317]

>>14780298
>No that is explicitly how a PCR test works.
No, you don't look for individual amino acids. I'd say that 5% of all proteins long enough have Asparagine in location 417, just from pure statistics. If the PCR tests would only look for that single amino acid, they would react to basically everything.

>They adjust the primers for each variant, and say "now use three then four then two" whatever.
But the primers still match the covid spike protein and not some yeast meiosis protein.

The mutations are used to identify which variant this is, not the fact that there's viral mRNA in the first place. You can't just "look" for a mutation. You look for spike with Lysine at position 417 and spike with Asparagine in position 417. Neither will react with MEI2 or some bullshit.

I wonder, did you come up with all this or did you find this somewhere? Everything with the mutations and where they occur.

[Anonymous No.14780374]

>>14780317
>But the primers still match the covid spike protein and not some yeast meiosis protein.

No it just checks for a specific, target of the RNA or DNA.
Not the whole S-Gene sequence.

It matches fragments of the S-Gene sequence.

And even when you would be right:

> Why would you check a specific target, of the spike protein, if the spike protein is already covid specific?

thats explicitly what they tell you.
They can't find a whole protein, they check for segments.

https://www.genome.gov/genetics-glossary/Primer

[Anonymous No.14780405]

>>14780374
>No it just checks for a specific, target of the RNA or DNA.
>Not the whole S-Gene sequence.
>It matches fragments of the S-Gene sequence.
But not one single amino acid! And it doesn't matter if it's a mutation or not, so your entire list of K417N etc. is completely nonsensical because ANY protein with N in position 417 would fulfill those criteria, not just the mutated ones.

Please tell me your source that the PCR test is "confused" by yeast. Is this your own theory, or do others also write about that?

[Anonymous No.14780436]

>>14780374
By the way, your own source says it:
>Dabei werden spezifische Mutationen mittels PCR erfasst, welche für Aminosäure-Austausche (bspw. P681R) oder/und Deletionen (bspw. Del157), meist innerhalb des Spikeproteins des Virus, verantwortlich und für relevante Viruslinien charakteristisch sind.
INNERHALB DES SPIKEPROTEINS. Nicht einfach so, egal, was außen rum ist.

[Anonymous No.14780567]

>>14780278
You should apply for mental gymnastics, you're good at jumping to conclusions.

[Anonymous No.14780652]

>>14780567
Why is it wrong to kill you, scientifically speaking? Is there any reason why people shouldn't come together and lynch anyone who sounds like you?

[Anonymous No.14780682]

>>14780652
Scientificially, lynch justice is a form of lack of safety. It is proven that safety is beneficial to a country's development and prosperity. That's why we lock up murderers.

[Anonymous No.14780685]

>>14780682
Scientifically speaking, why should I care about your bugman rheotoric instead of lynching you?

[Anonymous No.14780750]

>>14780685
Scientifically speaking, you cannot lynch me, since lynching is defined as extrajudicial killing by mob action and you are only one sad guy, not a mob. Therefore, this would be considered political murder, not lynching. Additionally, you have no idea who I am and where I live so scientifically speaking the only thing you can do is cope and seethe.

[Anonymous No.14780767]

>>14780436
>meist innerhalb des Spikeproteins des Virus,

> meist
> meist

Nicht Ausschließlich.
They pick one characteristic, and CLAIM its also idendification.

They never and nowhere claim:

> we look for a mutation that only happens on the spike protein

It's tricky rethorical wordplay.

PCR does not detect spike protein.

It detects any transcription mutation on any protein that you give it with as a primer.
You fall for the chuzpeh my friend.
The fine prints.

If you would look for the SPIKE protein. You would use a different encodig.

The say:
> mutation
> mutation can happen on spike protein
> if we detect 3 mutation it must be spike protein

[Anonymous No.14780799]

Pfizer and Moderna have both applied for Emergency Use Authorization for their new Omicron specific formulations. If they get it, one has to wonder if EUA will simply become the new normal for brining new therapeutics to market.

[Anonymous No.14780804]

>>14780750
>Scientifically speaking, you cannot lynch me
You're wrong, scientifically speaking. You can and should be lynched. You probably will be lynched, since you go out of your way to demonstrate that:
1. You can't be reasoned with
2. You're a malevolent Pfizer enforcement drone
3. Your life has no moral value

[Anonymous No.14780844]

>>14780767
>Nicht Ausschließlich.
Yes, they also look at other proteins. No, they don't look at some yeast meiosis proteins.

>It's tricky rethorical wordplay.
That's a funny way of saying "I misunderstood what they said". Also, it's a funny way of spelling rhetorical.

>PCR does not detect spike protein.
Wrong.
>It detects any transcription mutation on any protein that you give it with as a primer.
Um... no.


>The say:
>> mutation
>> mutation can happen on spike protein
>> if we detect 3 mutation it must be spike protein
No. If they detect these specific 3, they assume it's whatever variant that has these 3 mutations. The overall assumption is that they did discover a certain variant.

For real, take a step back and consider what you're saying. Let's say that only variant whatever has a replacement at location 417 from K to N, also denoted as K417N. If you find a coronavirus whose spike protein has a K in position 417, you know it's not this variant. If its spike protein has an N, that means it is.
Look at https://www.ncbi.nlm.nih.gov/protein/YP_009724390.1/ and find location 417. You'll find a K there.
For the yeast I actually only found the variant with the K in location 417: https://www.ncbi.nlm.nih.gov/protein/EAL85511.2
But you'll see, if you let a primer go on that region, that's hopeless. They are completely different. No chance of a primer docking to this because of a single k or n in a certain spot.
>msrage*k*nlhsprreisryp
>apgqtg*k*iadynyklpddft
Please tell me how on earth a primer would work for both these sequences, just because both proteins do not have that mutation in location 417 (highlighted).

[Anonymous No.14780850]

>>14780804
>You're wrong, scientifically speaking.
No. Definition of a mob: "a large and disorderly crowd of people"
A crowd consists of more than one person.
You: Sad lonely man.
[math]\Rightarrow[/math] you cannot lynch anyone, since you are alone and not part of a crowd.

[Anonymous No.14780852]

>>14780652
Scientifically speaking you won't do shit.

[Anonymous No.14780905]

> Dingdong, the witch is dead, the wicked witch is dead!
Anthony Fauci has submitted his resignation to President Biden. No word yet on who will be the new Pope of Public Health.

[Anonymous No.14780918]

>>14780905
>resignation
In December. When the dude will be 82. I'd cal this retirement, not resignation, but if it makes you happy.

[Anonymous No.14780951]

>>14780250
Comorbility. Is has been well known that people dying of other causes are counted as covid deaths as long they had traces of covid.

[Anonymous No.14780957]

>>14780951
At least for hospitalizations we know that most of them were hospitalized due to covid, not randomly with covid. Since Omicron it dropped a bit, but they still make up 50-60% of the cases where the cause is known:
https://www.covid19.admin.ch/en/epidemiologic/hosp?epiRelHospCause=rel
I can't imagine that it looks too differently regarding deaths.

[Anonymous No.14780965]

>>14780918
Doesn't matter what it is called, he will be gone. Call it ascension if you wish, the result is still the same, he's no longer there.

[Anonymous No.14780964]

>>14780951
>>14780957
In the first year of the pandemic, before vaccines and with the more lethal strains, it was over 90% of deaths:
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7539724/
Also, the reported covid deaths line up pretty well with the excessive number deaths:
https://www.cdc.gov/nchs/nvss/vsrr/covid19/excess_deaths.htm
Again, since March it looks much better in the US than in the previous waves. The relaxation doesn't exactly line up with the spread of Omicron: https://ourworldindata.org/grapher/covid-variants-area?country=~USA
But that's expected. Patients don't die the second they get infected, but rather spend a few horrible weeks in intensive care before their body finally gives up. Although the lag seems a bit long to me.

[Anonymous No.14780972]

>>14780965
So? Why would you care who the head of the NIAID and the chief medical advisor is in 2023? I can hardly come up with less interesting factoids. They won't do anything against the opioid crisis anyway. other medical-political things do you expect? How they vaccinate the gays against pridepox? How does this affect you?

[Anonymous No.14781012]

>>14780844
>Please tell me how on earth a primer would work for both these sequences

they don't thats why you get so many false positives.
It's not a differential diagnostic tool
the primers are crap.
The codes are there to idenfy them.
The mutations are all put there by catalogisation for each mutation.

A more specific mutation, gets a different code.
A code for a mutation is a code for a mutation, there is no "implicit" other protein which is also in the background in secret on the primer.

They select primers, of tiny miniscule mutations which are unspecific by them selved.

But if multiple mutations AT once in ONE test are found, they derive from the result "this might be a fragment of a Covid S-Gene"

thats it.

If they would use a more specific primer, the primer code would be specific.

Please show me, where and how the "background" information is contained whithin the target.

You made the positive claim, that its specific to the spike protein.

"Most PCR assays are indicated as an aid for diagnosis, therefore, health care providers must consider any result in combination with timing of sampling, specimen type, assay specifics, clinical observations, patient history, confirmed status of any contacts, and epidemiological information."
https://www.who.int/news/item/20-01-2021-who-information-notice-for-ivd-users-2020-05

It's a aid to diagnosis, a indicator, not a full spectrum diagnosis.

[Anonymous No.14781014]

>>14780905
Not good enough.
He needs to be tried and publicly executed for crimes against humanity.

[Anonymous No.14781027]

>>14781014
>tried and publicly executed
lol. He should be lynched without trial. That's how you keep """public officials""" in line, not by trying them under their own system.

[Anonymous No.14781058]

>>14780240
>>14780271
>JUST GET THE VAX! Everyone is doing it! It makes your life easier by giving back rights we already had!
>Its FREE! (No refunds and pharma not liable)
>Scared of needles you pussy???
>Stop being a bio-terrorist! MURDERER!!!
>Its safe and effective, and even if it isnt you should still get it!!
>Get it or else we take away your job and put you in a camp! Its for your own health! We care about you!

[Anonymous No.14781066]

>>14781012
>they don't thats why you get so many false positives.
?????
The primers don't accidentally replicate the yeast, that's why there are so many false positives?

>A code for a mutation is a code for a mutation, there is no "implicit" other protein which is also in the background in secret on the primer.
What distinguishes a mutation, let's say lysine in position 417 from a natural, unmutated lysine in another location?
How can a primer know which position it attaches to? How can it know that this is position 417 and not, let's say 416?

You seriously misunderstood PCR, completely independent of Covid.

[Anonymous No.14781078]

>>14781012
>...apgqtg*k*iadynyklpddft...
What distinguishes the k in position 417 from the k in position 424? If we have the mutation K417N, how can a primer tell that the n is due to a mutation and not normally there like in 422? It can only do that if it contains more of the sequence than just the mutation.

[Anonymous No.14781080]

>>14780905
>>14780918
>>14781014
Once his crimes came to light and the media stopped worshiping hes finally moving on as one of the most hated men in America.
>Fauci Says He Will Step Down in December to Pursue His ‘Next Chapter’
Let me guess, cushy pharma position with a big paycheck?
How the fuck is this dude not in fucking JAIL for murdering thousands of Americans?

[Anonymous No.14781085]

>>14781058
Wow you're such a fighter for human rights.

[Anonymous No.14781095]

>>14781080
>How the fuck is this dude not in fucking JAIL for murdering thousands of Americans?
The same reason Hillary is still not behind bars, even after 4 years of trump. Hint: your conspiracy theories are wrong. Wrong about Hillary, wrong about Fauci and most likely wrong about Hunter.

[Anonymous No.14781098]

>>14781066
"PCR" does not show a mutation.

The Codes have nothing to do with PCR.
It is just a sequence that allegedly produces a structure of a protein/amino acid, which is labeled as a mutation in the spike protein.
If its in a hemoglobin protein it might not be a mutation, but a regular part of the protein.

Specific parts of the sequence are responsible for encoding a mutation.

PCR can literally detect anything, it depends what you give it as a primer.
It can detect nicotine, organic molecules, hormones, enzymes and genetic material.

It does not matter what primer you give it, PCR is not a test its a amplification method.

It's only amplification, you can "interpret" the result, but its not a test, because you can use PCR to literally detect anything in everything.

Thats why you use primers, to narrow down some FRAGMENTED complex genetic stuff.
If you find multiple fragments that encode.

They currently use ONLY 2 primers.
Two.

[Anonymous No.14781099]

>>14781095
Scientifically speaking, how come people who use the term "conspiracy theory" in a derogatory manner tend to exhibit physical and mental deformities, low IQ, aphantasia and even suicidality?

[Anonymous No.14781100]

>>14781098
>PCR can literally detect anything, it depends what you give it as a primer.
It can detect nicotine, organic molecules, hormones, enzymes and genetic material.
How does that work? What's the polymerase doing with nicotine? What chain reaction takes place?

[Anonymous No.14781102]

>>14781095
>Literally piles of evidence anyone else would have been put in jail for
>Proven lie after lie after lie, they literally can't stop lying.
>untouchable because the system is designed to protect them
>media and shills constantly praise them no matter what, despite the proof

[Anonymous No.14781110]

>>14781098
>They currently use ONLY 2 primers.
>Two.
Which ones? Are the nucleotides public, or do they have other names one could use to find out more? You can buy countless (I stopped at 25) different primers online:
https://eu.idtdna.com/pages/landing/coronavirus-research-reagents/cdc-assays

[Anonymous No.14781111]

Why are people arguing about PRC tests? Its already well known PCR tests were used in a way that was prone to false positives of COVID. They did it on purpose to catch more cases even if it meant more false positives. Why is sci so dumb?

[Anonymous No.14781113]

>>14781102
>untouchable because the system is designed to protect them
What would happen if you walked into a police station and decided to sue Fauci?

[Anonymous No.14781123]

>>14781113
You don't sue in a police station. And there are lawsuits against Faucci and his policies. The problem is the people who are supposed to prosecute crimes committed by these people just decides not to. So I dont know what your point is other than being a retard.

[Anonymous No.14781146]

>>14781123
Sorry, in my country you do.
So as a private citizen you have no way to start a lawsuit? Wow, what kind of police state is this?

[Anonymous No.14781162]

>>14781146
You can sue him if you can find a judge who will accept the case. For criminal stuff though, the idea is you elect an executive officer (Mayor, governor, president) and then they nominate/appoint a district attorney/attorney general whos job it is to prosecute crimes.
The trick is that if your "team" holds the executive position and the prosecutor, they can just arbitrarily decide what laws to enforce and on who. Its becoming a huge problem here in America.

[Anonymous No.14781281]

>>14781110
Here is the list of primers:
https://www.rki.de/DE/Content/InfAZ/N/Neuartiges_Coronavirus/DESH/Tabelle_VOC-PCR-Finder.xlsx?__blob=publicationFile

For each variant other primers can be selected.

It depends on the laboratories protocol.

If you can obtain a PCR protocoll for BA.5 I would be happy.

[Anonymous No.14781305]

>>14781281
Anon, I--
Either my excel program doesn't show all sheets, or those are not primers.
Just to be clear what I'm talking about: I'm looking for sequences of the letters G, C, A, and T.

[Anonymous No.14781332]

>>14781281
Also, why are you so obsessed with variants? Normally they don't even determine the variant. Look at Switzerland:
>90,000 PCR tests in the last 14 days
https://www.covid19.admin.ch/de/epidemiologic/test?time=14d
>not a single determination of the variant
https://www.covid19.admin.ch/de/epidemiologic/virus-variants
Before that you see 2 per day, 7 per day etc. At the height they had a few hundred.

They don't determine the variant for a diagnosis. They might do it for research purposes, but you as a patient wouldn't know.

[Anonymous No.14781373]

>>14781281
>>14781305
Sorry, forgot about degenerated primers, there could also be an S or other letters in there. But most of them should be ATCG.

[Anonymous No.14781378]

>>14781305
>Just to be clear what I'm talking about: I'm looking for sequences of the letters G, C, A, and T.

try finding it.
You won't get the information:
https://journals.asm.org/doi/10.1128/mBio.02707-20#fig5

It's always the mutation code which is a certain segment.

>>14781332
Tests are shit, not even allowed to be used as a full diagnostic tool

> they still do it
> accuracy cannot be shown
> ct-value highly influence the result
> 3 years into pandemic, still no standartisation on ct value
> all based on questionable sequence from one patient, which is then used as template for all other subsequent variants

[Anonymous No.14781397]

>>14781378
Still with the replacements. Those are not primers.
https://www.sciencedirect.com/science/article/pii/S0166093421001361?via%3Dihub
Here you see primers. They look like
>GACCCCAAAATCAGCGAAAT
>ACCCCGCATTACGTTTGGTGGACC
>TCTGGTTACTGCCAGTTGAATCTG

That's not a single mutation. Actually, designing primers is its own challenge, because they should not be in regions where there is an overlap with other viruses and other things (just what you said, only you had a critical misunderstanding regarding K417N etc, you should have looked for GACCCCAAAATCAGCGAAAT). Also, they should not be in regions that are likely to mutate. Otherwise the test might not work with future strains.

So, where are the primers you're talking about? Did you understand now what a primer is and what it looks like?

[Anonymous No.14781425]

>>14781378
Take any of the sequences I quoted. Like TCTGGTTACTGCCAGTTGAATCTG and paste it in a search engine for proteins: https://blast.ncbi.nlm.nih.gov/Blast.cgi
Wait, I already did it for you.
https://blast.ncbi.nlm.nih.gov/Blast.cgi?CMD=Web&PAGE_TYPE=BlastSearch&VIEW_SEARCH=on&UNIQ_SEARCH_NAME=A_SearchOptions_1oQDmM_23TD_do7JdY5g120_GTW6B_1Hlp19

You'll only find SARS-CoV-2. No yeast, no SARS-CoV, no MERS, no Influenza.
I dare you, find me any other known protein in the world that contains
>TCTGGTTACTGCCAGTTGAATCTG

Can't? Well, in that case the specificity seems to be 100%.

[Anonymous No.14781496]

>>14776221
It was voluntary. Not a "lockdown".

[Anonymous No.14781515]

>>14781425
>>14781397
>>14781378
>>14781373
>>14781332
>>14781305
>>14781281
Autosage soon, but this debate is a slaughter. Shouldn’t have entered this debate unprepared, schizoid.

>>14781111

What a waste of quads.

[Anonymous No.14781540]

>>14781515
>shill mad he was blown out by quads of true science

[Anonymous No.14782677]

>>14781397
>>14781425

Yes assuming, that the PCR primers are habe a 100% integrity.
Which the don't have. Nothing has in genetics.
Because is literally impossible.

You will find a shitton of extremly similar structures everywhere.
Especcially in Human genome.

And other micro organisms.
If you assume, that the primers and aplification and primer binding are 100% accurate please verify that somehow.
Genetics is messy, and small contaminations will always occur.
Even the temperature has a result on the integrity of the result in any genetic method of observation.

You'll find multiple hundred matches just with the human sequences.

For:
> GACCCCAAAATCAGCGAAAT
> see picrel

Please don't tell me that "genetics" is accurate,
It's the most junk science, because everything is so fragile, that they have to produce "sequences" in silico.
And even then, the assembly is done mostly by an AI and probabilities which are nothing but guesstimations.

[Anonymous No.14782716]

>>14778531
Exactly, freedom of movement, freedom of self determined income, freedom to participate in society. All destroyed

>>14780799
Oy vey, there's a pandemic of pain. We need EUA for our new opioid which is 2x more addictive and 4x more expensive

>>14777787
I don't know how exactly they reached the 11% calculation but if they used WAIIS to independently determine the rate of vaccination (i.e. assume 11% is true) but they didn't properly corroborate this with WDRS (I.e. if they had a case on WDRS that didn't properly match WAIIS demographics, it automatically counted as unvaxxed), you can see how the unvaccinated could be overrepresented in the case data whilst also being accurately represented in the vaccine coverage data.

How many cases in WDRS were counted as unvaxxed due to missing data?
How did they cross link WDRS and WAIIS?

I'm saying we need this information to properly interpret this data.


>Does it matter if we count hospitalisation as WITH covid or DUE TO covid?
Well, for one thing it would determine whether the "vaccines reduce hospitalisations and serious illness" is utter moot

There is a complete lack of nuance with regards to analysis this data and it's showing even on /sci/

[Anonymous No.14782737]

>>14782677
>For:
>> GACCCCAAAATCAGCGAAAT
>> see picrel
See picrel for the alignment in your query. That's not how it works. You don't randomly align just 14 bases and ignore 10.

>Please don't tell me that "genetics" is accurate,
>It's the most junk science, because everything is so fragile, that they have to produce "sequences" in silico.
You clearly don't understand genetics. Not zero, unfortunately, but exactly epsilon that you manage to hit that Dunning Kruger sweetspot. You know so little that you are like epic fail guy and do everything wrong that you can. You know so little that you don't even realise how wrong you are. Seriously, you've made mistakes here that make me wonder if you have Abitur in biology. On the other hand, you know a fraction, you think you know what it means to search for mutations. You think you know what you're doing when you're placing with the parameters there, then come up with a query like yours where you match only half of the primer. No, you don't care to evaluate if the parameters you entered are realistic. You just claim it's junk because you played with the parameters, found garbage and then didn't stop to think about it the problem is your choice of parameters or genetics.

I'm sorry, at first I thought you were an antivaxxer who wants to smugly prove his lost point by lying constantly. Now I think you're actually catastrophically uneducated and dumb. You tried to convince me that they magically test for single nucleotides, failed to understand what a primer is several times and now embarrassed yourself again. Pick up a biology book, will you? Oberstufe Biologie would be enough to broaden your horizons.

[Anonymqus No.14782993]

>>14771932
old people loved using the word mineral, it's very odd

[Anonymous No.14783468]

>>14777276
>It was a dangerous virus with high mortality
woah almost as if it could have saved europe from a demographic collapse by offing boomers

[Anonymous No.14783480]

>>14783468
You mean, this was the secret plan all along? The people wearing masks were the subversive ones? The unvaccinated superspreaders were the cattle that did exactly what the government wanted?

[Anonymous No.14783487]

>>14783480
I said no such thing, only implied that covid could have been a blessing in disguise
instead we chose to cripple western civilization both economically and morally under the facade of saving a bunch of useless, obese eaters

[whoa No.14784268]

>>14777315
>>14777322
the 180, politically of people on the left going from >>14777344 to
>IT'S THE END TIMES
And the right doing the opposite over the course of about 2-3 months is peak clown world.
>>14763438
the real truth is that we won't know until the narrative is written in around 100 years (if we're alive).

[Anonymous No.14784302]

>>14783487
>we
Who? Not me. Not you. Not the anon you replied to. Whoever decided to force us into lockdowns is above the law.

[Anonymous No.14785550]

>>14784268
I always found it interesting that right and the left switched the positions that they held in early 2020, without much acknowledgement that it occurred.