Genetics Predicts Social Status: UC Davis

[Anonymous No.12779363]

New study from UC Davis tracked 400,000 English people across 1750 to 2020 showing that a simple additive genetics model better predicts social outcomes than a parental investment and community socialisation model:
http://faculty.econ.ucdavis.edu/faculty/gclark/ClarkGlasgow2021.pdf

Socio-economic success is primarily a question of breeding stock and genetic hygiene.

[Anonymous No.12779373]

>>12779363
Shut it down.

[Anonymous No.12779386]

>>12779363
does this compensate for the effects of inheritance and nepotism

[Anonymous No.12779387]

>>12779386
Oh, i should have read the image first
>better than everything except the transmission of wealth

You know what corelates strongly to the transmission of wealth? genetics.
But you know what correlates even stronger to the transmission of wealth? The transmission of wealth. And hey look at that the transmission of wealth is still top predictor!

[Anonymous No.12779392]

>>12779363
U S I N G
S
I
N
G

[Anonymous No.12779444]

Regarding the transmission of wealth, worse genetics (i.e. idiots) will squander it, whereas smart people won't.

[Anonymous No.12779449]

>>12779386
>>12779387
? what is your point?

[Anonymous No.12779466]

An R^2 value of 0.98? That seems inplausibly high, but quite shocking if true.

[Anonymous No.12779476]

>>12779466
no 0.98 is a correlation of correlations, also probably excludes the first correlation.

[Anonymous No.12779484]

>>12779476
Perhaps this is a misconception, but would this mean that genetics is responsible for 98% of the variation among wealth at death

[Anonymous No.12779497]

>>12779449
that the entire thing is clickbait
it only works in the current social norms where parents raise and help out their offspring in various ways. In say, some kind of society where dna is collected and humans are grown in vats and then given the exact same starting conditions the predictive power of genetics would go way down

[Anonymous No.12779505]

>>12779497
>In say, some kind of society where dna is collected and humans are grown in vats and then given the exact same starting conditions the predictive power of genetics would go way down
Reminder that the modern left unironically wants this outcome.

[Anonymous No.12779509]

>>12779505
>nooo equal opportunity is bad!
>my family wealth? well we just got that by pulling up on our boot straps :^)

[Anonymous No.12779529]

>>12779363
We have known this for years. Liberals will never acknowledge it.

[Anonymous No.12779534]

The Bell Curve said this decades ago and retards hated it

[Anonymous No.12779548]

>>12779387
You misunderstand. The genetics model predicts social status, i.e. job, education, income etc. better than the social model. Wealth however is influenced strongly by inheritance so, your parents and their position matters more than your genetics - if your parents died early that impacts your inheritance, if your parents have ten children that reduces your inheritance, but these things don't impact your social status.

[Anonymous No.12779563]

>>12779497
Go way up you mean. If you equalize all the environmental factors all that remains will be the genetic factors.

[Anonymous No.12779569]

>>12779363
If only rich people are smart then why is greed a from of dyscalculia?

[Anonymous No.12779575]

>>12779548
Not wealth. Transmission of wealth which is different.

[Anonymous No.12779596]

>>12779505
Wtf I like the left now.

[Anonymous No.12779603]

>>12779387
>>12779497
>>12779509
>my parents are poor and low IQ

Good luck with your life I guess...

[Anonymous No.12779625]

>>12779548
You must ask, why does the genetic model predict this position so well? The implication is that the underlying genetic factors play a much larger role. Or else, how would correlations between people, for example cousins, that have never met fit the model so well?

[Anonymous No.12779657]

>>12779548
>reduces your inheritance, but these things don't impact your social status.
because actual inheritance is only a small fraction of what you get having wealthy parents. You have far more resources growing up, you have their own social status brought about by their wealth to get you into the right circles starting out. You have family friends and acquaintances, met through these social circles your parents belonged to as a result of their wealth, who are all also wealthy who therefore are able to be resources you can use for starting careers.

Your parents wealth correlates to your social status unless you just totally reject your family and run off as a teenager or something.

[Anonymous No.12779719]

>>12779657
You inherit your genotype from your parents, and your parents are responsible for much of the enivronmental factors of your ontogenesis as a child becoming an adult, such that ontogeny is genetic in philosophical sense of being transmitted from parents to child then to the childs children.

[Anonymous No.12779727]

Ah yes the pleasures of dyscalculia, gathering everything you can get your grip on with out thinking twice.

[Anonymous No.12779735]

>>12779657
>Your parents wealth correlates to your social status unless you just totally reject your family and run off as a teenager or something.
Or, for instance, get adopted.

[Anonymous No.12779737]

My father was retarded in science, my mother was.
I scored best in class in physics, math an chemistry.
Now you can go back to the drafting table

[Anonymous No.12779760]

>>12779737
Truely inspiring, now what would a smart boy like your self be doing on 4chan? Really makes u think

[Anonymous No.12779781]

>>12779363
>Genetics
name them, name the genes/loci. a simple statistical correlation only suggests, it doesn't prove

[Anonymous No.12779821]

>>12779735
>Height
Goddamn

[Anonymous No.12779826]

>>12779781
We got a first one bois, the first midwit deboonker. Dumb fucker we don't need to know the specific gene to select for a trait, do you think that fucking indians knew it about loci to choose a plant or animal do selective breed. Ksy midwit .

[Anonymous No.12779875]

>>12779826
the traits they breed for in animals or plants don't have trillions of variables and btw they do know now what genes are responsible for these features and that's why they can gene edit them. that's the problem with social science, you will always have some retard say that your preference in toilets is genetic because they found a correlation but nothing is fully explained like in hard sciences.

[Anonymous No.12779947]

>>12779875

[Anonymous No.12779964]

>>12779363

[Anonymous No.12779979]

>>12779875
This is actually laughably wrong, there is now widespread use of polygenic predictions in animal breeding for complex traits, but even without genetic testing it's very easy to select for a complex trait as long as you have some half decent measure of it, i.e. height.

[Anonymous No.12779981]

>>12779363
But muh reality manifesting x threads

[Anonymous No.12780013]

>>12779603
>ER I G N
Huh?

[Anonymous No.12780030]

>>12779760
Why was Newton into Occultism lmao? Because people can also be retarded and have dumb fucking hobbies.

Or G.H. Hardy and cricket.

[Anonymous No.12780046]

>>12779363
These models are pitiful. No wonder social science is a joke

[Anonymous No.12780251]

>>12779979
again the cattle are bread for clearly identifiable traits. personality and social success aren't clearly identifiable traits. there are a lot of shitty studies/models like this that end up showing that you fashion style, obesity, number of sexual partners, career, political opinion, etc are genetic when all they did is compare parents and their children with some undergrad stats. i don't care what anyone says, i am not buying it if there isn't an actual gene test.

[Anonymous No.12780262]

>>12779363
Genetics are everything.
We WILL modify the genome and the germline and you can't stop me.

[Anonymous No.12780309]

>>12779484
no it just means that the model resembles a line with 98% accuracy

[Anonymous No.12780364]

>>12780251
>i don't care what anyone says, i am not buying it if there isn't an actual gene test.
There is - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6393768/

Let me guess, "education attainment isn't social status/it doesn't explain enough variance/tell me exactly what those genes do and how the human brain works."
>there are a lot of shitty studies/models like this that end up showing that you fashion style, obesity, number of sexual partners, career, political opinion, etc are genetic
All these things will of course be influence by genetics, how could they not be? So for a gene denialist, there will never be sufficient evidence that humans are actually animals and products of evolution.

[Anonymous No.12780590]

>class based british society has low social mobility throughout the 19th century
who would have thought

[Anonymous No.12780622]

>>12780590
Any examples of non-class based societies?

[Anonymous No.12780650]

>>12780622
Modern finland.

[Anonymous No.12780977]

>>12779737
In anecdotal evidence reliable? One man says yes

[Anonymous No.12780987]

>>12780650
You're not actually a finn, are you? If you are, you must be a midwit of epic proportions. The effect of the "welfare" state on educational attainment and wealth disappeared roughly one generation after the adoption of public schooling for all, indicating that midwits breed midwits regardless of how much the state tries to intervene in an individual's life.

"Free" school doesn't benefit an idiot.

[Anonymous No.12781181]

>>12780987
cool, now show me where the alleles are
inb4 "b-b-but inheritance studies"
>he doesn't know about nongenetic inheritance
shiggy

[Anonymous No.12781207]

>>12779363
>People born in a rich family become rich.
>Being rich has nothing to do with effort.

Did it seriously take until March 1st 2021 for science to realize this?

[Anonymous No.12781334]

>>12780309
>>12779484
Holy shit has anyone on /sci/ taken a single stat course?

R^2 is the proportion of variance explainable by the independent variable, yes it's high

[Anonymous No.12781432]

um, no sweetie we are blank slates, genetics can't control that. all people are equal, and its our systems that oppress and control us.
DIVERSITY IS OUR STRENGTH
HE WILL NOT DIVIDE US
DIVERSITY IS OUR STRENGTH
HE WILL NOT DIVIDE US
DIVERSITY IS OUR STRENGTH
HE WILL NOT DIVIDE US

[Anonymous No.12781457]

>>12779392
MAINLY
A
I
N
L
Y

SPOONS
P
O
O
N
S

[Anonymous No.12781466]

>>12779509
Why should we all be forced to be equal?
Why? Because it's unfair?
So what?

[Anonymous No.12781616]

>>12779363
>Day by day, year by year the hereditarians gain ground
Feels good bros.

[Anonymous No.12781862]

>>12781616
hereditarians are literally just learned helplessness authoritarians who are too tired to think so they just want to kill everyone not up to standard

[Anonymous No.12781885]

>>12781862
Actually it means I want to keep low IQ populations out of my fucking country, regardless of their individual IQ scores.

If that makes me authoritarian, all well, I'll accept that over being a lolbert.

[Anonymous No.12781915]

>>12781885
Sure, but when you develop a worldview where everything is genetically locked, you miss a lot of opportunity for improvement even among your ethnically homogenous country.

[Anonymous No.12781977]

>>12781915
>you miss a lot of opportunity for improvement even among your ethnically homogenous country.
You're conflating an intellectual understanding of the way the world actually functions with the phenomenological.

It very well could be that my every action isn't actually up to my free will, this doesn't mean I don't experience it as being due to my will, as such while my actual outcomes will largely be due to factors outside of my control, I can still act as though it is the case to maximize it.

However, acting as though something is a way and genuinely becoming deluded into thinking that it can only be that way, because of some "deeply held belief", moral or otherwise, is incredible stupid.

Unless you mean something even more retarded ala "Who cares if you're 90 IQ, you can still be anything you set your mind to!" tier platitudes.

[Anonymous No.12782001]

>>12781977
it's less philosophical and more that if you don't believe intelligence can be changed, then you will not venture into research how to improve it in people, born and yet to be conceived.

[Anonymous No.12782040]

>>12782001
Because intelligence largely can't be impacted in the manner you describe, sans gene editing.

The best you can accomplish currently is, reduction of negative impactors (malnutrition, etc).

[Anonymous No.12782178]

>>12780364
>So for a gene denialist
everyone knows genes influence everything, i am not denying this. i am just saying that with social stuff, there is a lot of room for bullshit and this stuff borders on vague nonsense and some of them have suspiciously high p values. if this stuff is to be scientific there should be a solid hard explanation of mechanisms, just like in chemistry and physics.
also you need to know what genes do what stuff if you want to gene modify humans. eugenics are hard to accept for the population when more than 70% of them are considered unfit or mediocre

[Anonymous No.12782196]

>>12779781
Retard. I guess genetics mean nothing by that logic.

[Anonymous No.12782214]

>>12782178
You clearly know fucking nothing.

[Anonymous No.12782382]

>>12782040
Just progesterone supplementation for a mother can significantly improve a childs IQ.
>malnutrition, etc
Even if there can only be a reduction of negative factors to reveal the """true""" IQ, there are so many negative factors that you will probably raise the average IQ of your nation by 10-20 points if you remove them all. Yes, even for supposedly nourished first worlders.

[Anonymous No.12782491]

>>12782214
lmao ironic
>>12779826
youre missing his point
>>12779781
this study isn't really about genetics as OP would want you to believe but rather more correlations in hereditary lineage. Its not accounting for which kids get which genes or anything like that. Rather all of the studies data is coming from relationship, not genetics.

[Anonymous No.12782495]

>>12782178
Retard
>>12782382
Nobody is stopping research because of genetics, retard. But let’s assume they did
>hurr durr genetics is everything
>make higher iq gene therapy and ignore hormones and nutrition
>have higher iq population without regard of nutrition and hormones
What a dystopia

[Anonymous No.12783094]

>>12780046
the unironic truth. people need their confirmation pills.

[Anonymous No.12783489]

>muh nutrition
Is anybody still pushing this meme? It would've been understandable when people were, well, malnourished. But in today's (first world) almost nobody is malnourished.

[Anonymous No.12783648]

>>12781466
Why shouldn't we all be forced to be equal? Because it's unfair to the oppressors?
So what?

[Anonymous No.12783848]

>>12783489
>almost nobody is malnourished.
oh my sweet soul
if only you knew

[Anonymous No.12783955]

>>12783489
I’d say they’re malnourished and overweight, eating lots of shitty food that is low in nutrition doesn’t mean you are well nourished.

[Anonymous No.12783981]

>>12783955
So they are low IQ because they eat too much. Got it.

[Anonymous No.12784102]

>>12783981
I guess reading comprehension must not correlate with IQ.

[Anonymous No.12784141]

>>12784102
I don't see how "malnourished" and "fat" can be written in the same sentence.

[Anonymous No.12784168]

>>12784141
Malnourished of micronutrients while getting too many macronutrients.

[Anonymous No.12784246]

>>12784168
I don't see why fatties should be more starved of micronutrients than people with normal BMIs. Even normal people have vitamin deficiencies, you know.

[Anonymous No.12784564]

>>12783489
obesity =! nourishment. a lot of people in the 1st world are deficient in so many things that actually matter for brain development like many minerals, vitamins, etc. they should give children in school foods that have these stuff but conservatards consider anything with goberment to be satan and violation of their rights

[Anonymous No.12784614]

>>12784564
>It's the gubbement's fault
Why are amerifats so retarded

[Anonymous No.12786055]

>>12782382
>rogesterone supplementation for a mother can significantly improve a childs IQ.
Sauce

>you will probably raise the average IQ of your nation by 10-20 points if you remove them all. Yes, even for supposedly nourished first worlder
What an utterly ridiculous statement, the first world has the best nutrition and prenatal care available, there is little outside of that that would impact it (I'm assuming you don't fall for meme factors such as school quality)

[Anonymous No.12786060]

>>12782491
>>12782178
>Dude, toss out 99% of what we know about biology because I DEMAND a mechanistic explanation
Unironically kys.

[Anonymous No.12786190]

>>12781885

Isn't that just creating an ethnostate with extra steps? It is okay OP, it is fine to dislike the blacks, this is 4chan.

[Anonymous No.12786213]

>>12786190
>Isn't that just creating an ethnostate with extra steps?
No, I'd have little to no issue with Ashkenazi, Japs or Chinese immigrating since the aforementioned do come from populations with high aggregate intelligence.

The question is can you assimilate them without them forming an identity of "Japanese American" for example that distinguishes and puts a constructed boundary between them, whites and other minorities.

I believe it would be possible if the immigration was distributed across the country in low numbers, unfortunately that's not really an option.

Furthermore, I don't believe mass deportations would be possible for what is >40% of America, though I suppose it would be plausible for some European countries.

So in short, no, it's not plausible unless you're willing to deport hundreds of millions of people to countries they've likely never even been to.

[Anonymous No.12786959]

>>12786055
>the first world has the best nutrition and prenatal care available
No exactly that care is defendant on the nation. The US has lot of maternal care issues but is also one of the best.

[Anonymous No.12786969]

>>12779444
>worse genetics (i.e. idiots) will squander it
Only in EXTREME cases. There's a lot of rich people who will stay rich dumb or poor becuase their wealth is self sustaining. That's the thing about being rich, there's several tiers of it and after a certain level you start entering "fuck you money" levels of wealth.

[Anonymous No.12787247]

>>12786060
social science isn't biology.
anyway so tell me smartass, how do you gene modify humans to increase social outcomes without having done any gene tests or located any genes or loci?

[Anonymous No.12787407]

>>12787247
SNPs are being identified. Current tech would give you a 3 point boost in IQ, worthless for the individual, useful perhaps for an entire population. Could be much much more in the future.

[Anonymous No.12787466]

>>12787247
>social science isn't biology.
This just demonstrates you have 0 understanding of how the actual field functions.

>how do you apply mechanistic methods when you don't know the mechanism
You don't.

I'll illustrate how retarded you're being:
>I'm going to breed a cow that has greater yields of meat
>Do you know what specific genes will affect that?
>No, you don't need to know the specific genes to infer a genetic cause
>Well how are you going to edit the genes of the cow without knowing the specific genes smartass?

[Anonymous No.12787540]

>>12779387
What makes wealth stick with a family? Better spending and inter-generational forethought.
This includes marrying people with the same social status, which is correlated with genetics, as this will make you and your partner better handle your wealth and inheritance to pass it down by the time you die.

If I marry a bimbo for her tits, then no matter what my IQ and social status are, my kids will end up with spoiled genes to maintain or grow the wealth they'll inherent.

This is why most rich families never have their wealth last beyond the third generation, and those who don't, don't have the spirit of their dead wealth-founding great grandpa guiding them around. They have the genes which foment the family tradition of knowing how and where to put your money.

There is no magical spell that the transmission of wealth does to make people still have that wealth to transmit again by the time they die. The mechanism underlying the transmission of wealth is, at its core, genetic.

[Anonymous No.12787591]

>>12779363
>nature before nurture
Will be revoked in 3, 2, 1,...

[Anonymous No.12787597]

>>12780013
He's calling you a ginger.

[Anonymous No.12787604]

Good genes = good looking = free money and instant status. Imagine my shock

[Anonymous No.12787611]

>>12787604
Who's that uberchad next to Loki?

[Anonymous No.12787620]

>>12787611
me

[Anonymous No.12787677]

>>12787620
Very cool, Anon.

[Anonymous No.12787734]

>>12780251
Fortunately nobody gives a shit what your dumbass is buying or not.

[Anonymous No.12787835]

>>12779387
Then again the best way to be eligible for such wealth transfer is to be genetically linked to the individual.

[Anonymous No.12787982]

>>12781207
My God, are you that dumb?

[Anonymous No.12788004]

>genetics effect animals and their behavior, we know this for decades know, yes, environment is important, but overall genetics is much important, we can select and breed animals based on traits, even if we no nothing of the genes behind


>NOOOOOOOOOOOOOOOOOOOOO you can't say that behavior of humans, are effect by their genes, THAT'S RACIST AND AUTHORITIAN, SHUT IT DOWN, FUCKING RACIST, JUST DON'T PUBLISH AND DON'T LET PEOPLE READ IT AND ACTUALLY CRITIZICE THE STUDY, JUST LET CENSOR BECAUSE IT RACIST!!!!!

Do people are really that mentally insane? This types of people are dangerous for freedom of thought, kind of ironic, saying that they are rational and free to open ideas but when their ideology gets a beat they turn into irrational animals, quiet honest they the day of the rope is coming for this type of people.

[Anonymous No.12788023]

>>12779781
Don't know nothing about genetics.

>>12779875
Don't know about genetics

>>12779979
Don't know about genetics

>>12781862
Now that cope right there, you are actually a science denier because it doesn't agree with your worldview, unironically not gonna make it.

>>12783094
>>12783094
Actually does have some flaws, but their is 50 years of genetics behavioral behind some yeah, step up your game before saying shit.

[Anonymous No.12788030]

>>12788004
This isn't new, practically whatever ideology becomes king of the hill takes on that flavor of not being open to any new ideas. Neoliberalism is on top now and has that character as a result.

[Anonymous No.12788034]

>>12788023
O yeah if you know so much about genetics, recite the entire human genome from memory.

[Anonymous No.12788047]

>>12788030
Again, science and ideology doesn't go well, just luck at this thread is full of people straight up denying the science of genetic and evidence that genes effect people path in life, well, being honest, is a hard pill to swallow that society in some or other is actually quiet fair, sure, in a very brutal Darwinian way, so some people with good gene rise up, and people with bad genes go down, as capitalism select for some type of people, I wonder what type of people a socialist society would select for, I bet some corrupt and lazy type of people, if the entire world as socialist, I bet the world would be a very stalled and not creative and have a very low quality of life.

[Anonymous No.12788093]

>>12779363
This should surprise absolutely no one except for radical marxist trannies.

[Anonymous No.12789139]

>>12787466
meatier cows is an easily and clearly identifiable trait, personality, status, etc aren't. cow meat isn't affected by nurture when the two cows live under the same optimal conditions, personality, social aspects, etc are.
i don't know how biologists do their research but the problem with these kind of studies is that you can take literally any two values and you will find a p value higher than 0, especially when you are matching something with genetics. one of the main principles in science is that you can't do that (you can sometimes but you need p hacking, accounting for other variables and a lot things like that to have a more solid result, which are absent in this study), this is literally one of the examples they teach with the Bayesian theorem and statistics. if biology is like this then no wonder females like it and the only part of it which is making actual progress is the part that uses "mechanistic methodology". social science will simply never be science, you literally can't replicate a single study, everything is vague and gets redefined a million times, nothing even means anything or can be applied in any useful way other than marketing

[Anonymous No.12789787]

>>12788093
Radical Marxist trannies control public discourse

[Anonymous No.12790915]

>>12789139
>meatier cows is an easily and clearly identifiable trait, personality, status, etc aren't
>occupational status, income, health, and wealth is difficult to measure

>one of the main principles in science is that you can't do that
Explain where within the scientific method that statistical correlation is an invalid methodology.

> the only part of it which is making actual progress is the part that uses "mechanistic methodology"
This is meaningless, define "actual progress".

>you literally can't replicate a single study
Positively false, regardless of whether we're talking about "social science" or biology as a field.

[Anonymous No.12792120]

>>12779497
>some kind of society where dna is collected and humans are grown in vats and then given the exact same starting conditions the predictive power of genetics would go way down
Go way UP FTFY

[Anonymous No.12792134]

>>12788034
acgtgcattgctgacgtactgagtcgtacgtatgcgtagtcgatcagtcgtagtcgtacgtagtcgtagtcagtcgtagtcgtagctgatcgtagtcgtagtcagtcgtagtcgtatgcgtagtctgacgtagtcgtagctagtcgtagtcgtagtcgtacgtagtcgtagtcgtacgtgatcgtagtcgtacgtagtcgtagtcgatcgtgtcagtagtcgtcagtacgtcgcgcgtacgtatgctgacgtagtcagtcgtatgcagtctgagtcgtacgtagtcgtacgtatgctgacgtacgtatgcgtacgtacgtactgagtcgtacgtacgtatcgtagctacgtagctagcgcgtacgatcgatcgatcgatcgtacgtagctagcniggeracgctagtcagtcgtacgtagtcgtacgtagtcgtacgtatctgatgcatgcgtatgcgtactgatgcgtactgagtcgtatctagcgtagtcgtatgcgatcgtatgcgtagtctgagctagtcgtatgcgtatgcagtcgtagtcgtacgatgcgtacgtacgatcgatgctacgtagcatgcatctagcatgctagctagctagctagctagctacgatcgtacgtacgtagcatcgatcgatctgagtcgactgagtcgtacgtatgcgatcgatgctgatgctgactgagtctgagtcatgcgtatgcgtagtcatgcgtatgcgtatgcgtagctagtcgtatgcgtatgcgtacgtatgcgtatgcgtactgagtcgtagtcagtcgtagtcgtagctagtcgtagtcgtagtcagtcgtagctagtcgtagtcgtacgtagtcgtacgtatgctgagtcgtagtcgtacgtagtcgtacgtatgctgagtcgtagtcgtacgtagtcgtacgtatgctgagtcgtagtcgtacgtagtcgtacgtatgctgagtcgtagtcgtacgtagtcgtacgtatgctgagtcgtagtcgtacgtagtcgtacgtatgctgagtcgtagtcgtacgtagtcgtacgtatgctgagtcgtagtcgtacgtagtcgtacgtatgctgagtcgtagtcgtacgtagtcgtacgtatgctgagtcgtagtcgtacgtagtcgtacgtatgctgagtcgtagtcgtacgtagtcgtacgtatgctgagtcgtagtcgtacgtagtcgtacgtatgctgagtcgtagtcgtacgtagtcgtacgtatgctgagtcgtagtcgtacgtagtcgtacgtatgctgagtcgtagtcgtacgtagtcgtacgtatgctgagtcgtagtcgtacgtagtcgtacgtatgctgagtcgtagtcgtacgtagtcgtacgtatgctgagtcgtagtcgtacgtagtcgtacgtatgctgagtcgtagtcgtacgtagtcgtacgtatgctgagtcgtagtcgtacgtagtcgtacgtatgctgagtcgtagtcgtacgtagtcgtacgtatgctgagtcgtagtcgtacgtagtcgtacgtatgctgagtcgtagtcgtacgtagtcgtacgtatgctgagtcgtagtcgtacgtagtcgtacgtatgctgagtcgtagtcgtacgtagtcgtacgtatgctgagtcgtagtcgtacgtagtcgtacgtatgctgagtcgtagtcgtacgtagtcgtacgtatgctgagtcgtagtcgtacgtagtcgtacgtatgctgagtcgtagtcgtacgtagtcgtacgtatgctgagtcgtagtcgtacgtagtcgtacgtatgctgagtcgtagtcgtacgtagtcgtacgtatgctgagtcgtagtcgtacgtagtcgtacgtatgctgagtcgtagtcgtaagtcgtagtcgtacgtagtcgtacgtatgctgagtcgtagtcgtacgtagtcgtacgtatgctgagtcgtagtcgtacgtagtcgtacgtatgctgagtcgtagtcgtacgtag

[Anonymous No.12792158]

>>12783648
>Why shouldn't we all be forced to be equal?
>Why should we all be forced to be equal?
no reasons for either, rather we should keep the status quo :)

[Anonymous No.12792175]

>>12779497
>>12779563
>>12792120

You're all morons. If you standardize environmental factors, and because genes don't exist and are made up by white people so they can be racist, then astrology will have 100% predicting power.

[Anonymous No.12792185]

>>12792175
too grammatically correct, 7/10

[Anonymous No.12792515]

>>12792158
No reason for that either.

[Anonymous No.12792699]

>>12781862
You speak like a parasite

[Anonymous No.12792732]

>>12792699
you speak like a slave

[Anonymous No.12792908]

>paper ends on a call for socialism

[Anonymous No.12792999]

>>12779781
That would also just be a statistical correlation. Everything in science is ultimately a statistical correlation. Do you even induction, bro?

[Anonymous No.12794004]

>>12792999
>>12788023
>>12787466
>>12786060
>>12782495
>>12782491
>>12781432
>>12780251
>>12779979
>>12779875
>>12779781
>>12779735
>>12779603
>>12779548
>>12779466
>>12779386
>>12779363

[Anonymous No.12794047]

>>12784564
You have biden, be happy.

[Anonymous No.12794054]

>>12794004
b8

[Anonymous No.12794070]

>>12794047
i am talking about the uk retard, i know leftists can be retarded but giving children food that is supplemented with vitamins and minerals they are commonly deficient in would improve the population health so much. the only reason someone would reject this is if they hate kids and everyone

[Anonymous No.12794075]

>>12794004
kek, I've always wondered why spics are terrible drivers.

[Anonymous No.12794080]

>Personally I would argue that this should push us towards compressing differences in income and wealth that are the product of such inherited characteristics. The Nordic model of the good society looks a lot more attractive than the Texan one.
What in tarnation

[Anonymous No.12794128]

>>12787540
Money is a product of things, its a side effect of social status, not a cause of it. Social status allows for nepotism which creates money.

It has nothing to do with genetics, it has to do with family social relationships.

The reason in modern day 'rich families' (they arent really rich) dont do as well is because those families became rich by happenstance under the modern socio-economic system that does allow random people to occasionally get lucky.

[Anonymous No.12794205]

>>12784564
Face it, the US isn't 1st world anymore.

[Anonymous No.12794210]

>>12787247
>how do you gene modify humans to increase social outcomes without having done any gene tests or located any genes or loci?
You marry into a good family and allow only people from a good family to marry into yours.

[Anonymous No.12794218]

>>12794205
This isn't just a problem in the US. Weight is an issue in Canada and the UK too.

[Anonymous No.12794753]

>>12794205
this is a problem of all first world. here in norway they used to provide children with healthy free meals, nowdays it's not free and the school canteens sell sugary trash and shit

[Anonymous No.12794851]

>>12794218
>>12794753
Overweight population =/= malnourished population. There is no case to be made that non Europeans in Europe are malnourished due to obesity more than the native people. In fact, the native ones seem to be fatter.

[Anonymous No.12794886]

>>12794004
weak bait.

[Anonymous No.12794966]

>>12794128
What kinda schizo talk is this?

Claiming nepotism and social family relations is conspiratorial when we know 90% of them lose their wealth by the third generation, with plenty of examples from before "modem day rich families" from Twain, Strohs, Pulitzers, Hartfords, Vanderbilts, etc. All filthy rich families that lost it all.
The reason families like the Rockefeller are still relatively, but way less, wealthy isn't because they were "lucky" (aka magic) but because they invest wisely, manage their risks. Something I wouldn't expect a leftist to understand and rather like you did here, fall back to conspiracy superstitious talk.

>It has nothing to do with genetics, it has to do with family social relationships.
You're going into schizo assumptions of nepotism and family relations when the paper says otherwise.
I might as well plug Jews and you'd sound like a poltard.

We know couples marry others with similar genetics in general.
You'd expect in a highly nepotistic and "keep in the family" attitude towards money, people would marry their cousins which will keep the wealth in, but guess what? Marital assortment correlation with social outcome was lower in societies where people were married to random cousins.

If we let people loose to pick their partners, this would be way different:
>As predicted, couples showed significant similarity for some IQ variables.
>https://www.sciencedirect.com/science/article/abs/pii/0191886985901400

>Genetic evidence of assortative mating in humans
>https://blog.23andme.com/23andme-research/you-complete-me/
Study linked. Spam filter borked.

This is genetic. People are attracted to people who are similar to them.
There is no magic spell with wealth, most families lost it, even nepotism loses it, rather just the smarties know how to manage it and teach their kids how to as well and marry people like them, and for dumbasses like you, it would obviously look like magic. Even Isaac Newton lost his wealth on bad investments.

[Anonymous No.12795028]

>>12794886
>weak bait.
if it's weak then it should be easy to disprove