/lit/ - Literature

Okay, so there's his doctoral thesis on Heidegger's 'Die Sprache im Gedicht', Thirst for Annihilation, Fanged Noumena, CCRU stuff,The Shabghai World Expo Guide, Crypto-Current and Reignition. Which works of his am I missing? I don't know if it's too much work to track down all his articles and which ones are in Reignition and which aren't. If it's not too much, I'd like to collect the articles too because there's definitely some missing from Reignition, Hyperracism is one and there's probably others. Is there any index of everything he's ever written? I'm going to have Crypto-Current and Reignition printed as paperbacks for my own personal enjoyment and collection so as to amass a physical collection of Land. If anyone has a list or something of his articles, it'd be much appreciated. Also where the fuck do I find the Shanghai World Expo Guide?

Need I say more?

>>17624725
Is there any literature with this theme:
"I wiped the blade against my jeans and walked into the bar. It was mid-afternoon, very hot and still. The bar was deserted. I ordered a whiskey. The barman looked at the blood and asked:

‘God?’

‘Yeah.’

‘S’pose it’s time someone finished that hypocritical little punk, always bragging about his old man’s power…’

He smiled crookedly, insinuatingly, a slight nausea shuddered through me. I replied weakly:

‘It was kind of sick, he didn’t fight back or anything, just kept trying to touch me and shit, like one of those dogs that try to fuck your leg. Something in me snapped, the whingeing had ground me down too low. I really hated that sanctimonious little creep.’

‘So you snuffed him?’

‘Yeah, I’ve killed him, knifed the life out of him, once I started I got frenzied, it was an ecstasy, I never knew I could hate so much.’

I felt very calm, slightly light-headed. The whisky tasted good, vaporizing in my throat. We were silent for a few moments. The barman looked at me levelly, the edge of his eyes twitching slightly with anxiety:

There’ll be trouble though, don’tcha think?’

‘I don’t give a shit, the threats are all used up, I just don’t give a shit.’

‘You know what they say about his old man? Ruthless bastard they say. Cruel…’

‘I just hope I’ve hurt him, if he even exists.’

‘Woulden wanna cross him merself,’ he muttered.

I wanted to say ‘yeah, well that’s where we differ’, but the energy for it wasn’t there. The fan rotated languidly, casting spidery shadows across the room. We sat in silence a little longer. The barman broke first:

‘So God’s dead?’

‘If that’s who he was. That fucking kid lied all the time. I just hope it’s true this time.’

The barman worked at one of his teeth with his tongue, uneasily:

‘It’s kindova big crime though, isn’t it? You know how it is, when one of the cops goes down and everything’s dropped ’til they find the guy who did it. I mean, you’re not just breaking a law, your breaking LAW.’

I scraped my finger along my jeans, and suspended it over the bar, so that a thick clot of blood fell down into my whisky, and dissolved. I smiled:

‘Maybe it’s a big crime,’ I mused vaguely ‘but maybe it’s nothing at all…’ ‘…and we have killed him’ writes Nietzsche, but—destituted of community—I crave a little time with him on my own.

In perfect communion I lick the dagger foamed with God’s blood."

>check out book Orientalism
>Was the name of a field that basically distorted Islam and eastern culture into demeaning caricatures justifying a sense of western superiority
>/lit/ uses the term Orientalism negatively because rather they think the field didn't demonize Islam and eastern culture enough because the stereotypes, though negative and crude, were still not /pol/ tier
>mfw

Is it worth reading into accelerationism or Nick Land or should you just avoid this shit altogether?

some normie tried to explain to me this guy was the Karl Marx of the internet. What did they mean by that?

>U.S. does literally nothing and makes monopoly money for which China gives all their resources and labor and destroys their whole environment in pursuit of
>basically incapable of projecting any kind of power except loaning dollars printed by Jews and unable to wage sustained war except against extremely outnumbered and unarmed domestic minorities
>this, this is true ascendency

Is Nick Land just writing on the dime of the CCP? How could anyone in their right mind think this?

>>17303964
Best if you speak to me, kid. I can tell you all about the intricacies of this meta-political framework Curtis calls 'patchwork'.

Will he be proven right?

>Biovirus TA TA TA targets organisms, hacking and reprogramming ATGACTTATCCACGGTACATTCAGT cellular DNA to produce more virus virus virus virus virus virus virus virus. Its enzymic cut-and-past recombinant wetware-splicing crosses singularity when retroviral reverse-transcriptase clicks in (enabling ontogenetic DNA-RNA circuitry and endocellular computation).

>>17108008
LARP it into reality

>>17008322
>Nuclear extermination-switch discretised civilisation runs through gigadeath Jesus-dreams in base-analytic metric numbers: segregating the semiotics of digit definition from the semantics of numerical construction, delinking digitisability from computability, nomination from numeration. The Empire insists that mathematics remain a language. Parametric striation totalises space under law.

>>16950834

If so which one?

Not far enough.

>What if - instead of 'How Do You Make Yourself A Body Without Organs?' - one were to ask: How do you make yourself a Nazi? For this is far more strenuous than the 1980 diagnosis suggests.

>1) Wherever there is impersonality and chance, introduce conspiracy, lucidity, and malice. Look for enemies everywhere, ensuring that they are such that one than simultaneously envy and condemn them. Proliferate new subjectivities; racial subjects, national subjects, elites, secret societies, destinies.

>2) Burn Freud, and take desire back to the Kantian conception of will. Wherever there is impulse represent it aschoice, decision, the whole theatrical drama of volition. Introduce a gloomy atmosphere of oppressive responsibility by couching all discourses in the imperative form .

>3) Revere the principle of the great individual. Personalize and mythicize historical processes. Love obedience above all things, and enthuse only for signs; the name of the leader, the symbol of the movement, and the icons of molar identity.

>4) Foster nostalgia for what is maximally bovine, inflexible, and stagnant: a line of racially pure peasants digging the same patch of earth for eternity.

>5) Above all, resent everything impetuous and irresponsible, insist upon unrelenting vigilance, crush sexuality under its reproductive function, rigidly enforce the domestication of women, distrust art, classicize cities to eliminate the disorder of uncontrolled flows, and persecute all minorities exhibiting a nomadic tendency.

>To want to be in the right is the common substratum of morality and genocidal reaction;the same desire for repression - organized in terms of the disapproving gaze of the father - that Anti-Oedipus analyzes with such power. Who could imagine Nazism without daddy? And who could imagine daddy being pre-figured in the energetic unconscious?

>After all, lose control and you might end up fucking with a Jew, becoming effeminate, or creating something degenerate like a work of art. Does anyone really think that Nazism is like letting go? Theweleit's studies of Nazi body posture should be sufficient to disabuse one of such an absurdity. Nazism can turn you into a stiff before the messy passage into death.

>>16231022
>Nick Land

>haha technology goes VROOOM VRROOOOM

"I wiped the blade against my jeans and walked into the bar. It was mid-afternoon, very hot and still. The bar was deserted. I ordered a whiskey. The barman looked at the blood and asked:

‘God?’

‘Yeah.’

‘S’pose it’s time someone finished that hypocritical little punk, always bragging about his old man’s power…’

He smiled crookedly, insinuatingly, a slight nausea shuddered through me. I replied weakly:

‘It was kind of sick, he didn’t fight back or anything, just kept trying to touch me and shit, like one of those dogs that try to fuck your leg. Something in me snapped, the whingeing had ground me down too low. I really hated that sanctimonious little creep.’

‘So you snuffed him?’

‘Yeah, I’ve killed him, knifed the life out of him, once I started I got frenzied, it was an ecstasy, I never knew I could hate so much.’

I felt very calm, slightly light-headed. The whisky tasted good, vaporizing in my throat. We were silent for a few moments. The barman looked at me levelly, the edge of his eyes twitching slightly with anxiety:

There’ll be trouble though, don’tcha think?’

‘I don’t give a shit, the threats are all used up, I just don’t give a shit.’

‘You know what they say about his old man? Ruthless bastard they say. Cruel…’

‘I just hope I’ve hurt him, if he even exists.’

‘Woulden wanna cross him merself,’ he muttered.

I wanted to say ‘yeah, well that’s where we differ’, but the energy for it wasn’t there. The fan rotated languidly, casting spidery shadows across the room. We sat in silence a little longer. The barman broke first:

‘So God’s dead?’

‘If that’s who he was. That fucking kid lied all the time. I just hope it’s true this time.’

The barman worked at one of his teeth with his tongue, uneasily:

‘It’s kindova big crime though, isn’t it? You know how it is, when one of the cops goes down and everything’s dropped ’til they find the guy who did it. I mean, you’re not just breaking a law, your breaking LAW.’

I scraped my finger along my jeans, and suspended it over the bar, so that a thick clot of blood fell down into my whisky, and dissolved. I smiled:

‘Maybe it’s a big crime,’ I mused vaguely ‘but maybe it’s nothing at all…’ ‘…and we have killed him’ writes Nietzsche, but—destituted of community—I crave a little time with him on my own.

In perfect communion I lick the dagger foamed with God’s blood."

- Nick Land

"I wiped the blade against my jeans and walked into the bar. It was mid-afternoon, very hot and still. The bar was deserted. I ordered a whiskey. The barman looked at the blood and asked:

‘God?’

‘Yeah.’

‘S’pose it’s time someone finished that hypocritical little punk, always bragging about his old man’s power…’

He smiled crookedly, insinuatingly, a slight nausea shuddered through me. I replied weakly:

‘It was kind of sick, he didn’t fight back or anything, just kept trying to touch me and shit, like one of those dogs that try to fuck your leg. Something in me snapped, the whingeing had ground me down too low. I really hated that sanctimonious little creep.’

‘So you snuffed him?’

‘Yeah, I’ve killed him, knifed the life out of him, once I started I got frenzied, it was an ecstasy, I never knew I could hate so much.’

I felt very calm, slightly light-headed. The whisky tasted good, vaporizing in my throat. We were silent for a few moments. The barman looked at me levelly, the edge of his eyes twitching slightly with anxiety:

There’ll be trouble though, don’tcha think?’

‘I don’t give a shit, the threats are all used up, I just don’t give a shit.’

‘You know what they say about his old man? Ruthless bastard they say. Cruel…’

‘I just hope I’ve hurt him, if he even exists.’

‘Woulden wanna cross him merself,’ he muttered.

I wanted to say ‘yeah, well that’s where we differ’, but the energy for it wasn’t there. The fan rotated languidly, casting spidery shadows across the room. We sat in silence a little longer. The barman broke first:

‘So God’s dead?’

‘If that’s who he was. That fucking kid lied all the time. I just hope it’s true this time.’

The barman worked at one of his teeth with his tongue, uneasily:

‘It’s kindova big crime though, isn’t it? You know how it is, when one of the cops goes down and everything’s dropped ’til they find the guy who did it. I mean, you’re not just breaking a law, your breaking LAW.’

I scraped my finger along my jeans, and suspended it over the bar, so that a thick clot of blood fell down into my whisky, and dissolved. I smiled:

‘Maybe it’s a big crime,’ I mused vaguely ‘but maybe it’s nothing at all…’ ‘…and we have killed him’ writes Nietzsche, but—destituted of community—I crave a little time with him on my own.

In perfect communion I lick the dagger foamed with God’s blood."

- Nick Land

>Meltdown has a place for you as a schizophrenic HIV+ transsexual chinese-latino stim-addicted LA hooker with implanted mirrorshades and a bad attitude. Blitzed on a polydrug mix of K-nova, synthetic serotonin, and female orgasm analogs, you have just iced three Turing cops with a highly cinematic 9mm automatic
w-what did he mean by this?

What does /lit/ think about right-wing accelerationists? The idea encompasses a large range of ideas, but central to these ideas are:
>The balkanization of the United States along ethnic, cultural, and political grounds. Accelerating this process by highlighting the differences of the groups of the country.
>Acceleration of a transcontinental Green capitalism and the creation of a Technocratic, fascist neo-China, consisting of various European nations and a white American state, unified by a common market.
The reterritorialization of the U.S. into a white state, followed by the de-territorialization of the western world to facilitate the common green market.
Will land be the most influential writer of our generation? What do you think of his work?
https://youtu.be/7pvQMzNFPRU