/lit/ - Literature

File: 12 KB, 171x266, 198384.jpg [View same] [iqdb] [saucenao] [google]

Anonymous Mon Dec 28 22:13:11 2020 No.17143536 [Reply] [Original]

>Biovirus TA TA TA targets organisms, hacking and reprogramming ATGACTTATCCACGGTACATTCAGT cellular DNA to produce more virus virus virus virus virus virus virus virus. Its enzymic cut-and-past recombinant wetware-splicing crosses singularity when retroviral reverse-transcriptase clicks in (enabling ontogenetic DNA-RNA circuitry and endocellular computation).

>>	Anonymous Mon Dec 28 23:52:10 2020 No.17144230 >>17143536 Land was always a stupid fuck

>>	Anonymous Mon Dec 28 23:53:24 2020 No.17144236 >>17144230 :'(

>>	Anonymous Tue Dec 29 02:19:20 2020 No.17145042 >>17143536 I remember last year around this time when everyone was sucking Lands dick like he was the next coming of Christ. It seems the only constant clock slobbering on this board is reserved for Nietzsche

>>	Anonymous Tue Dec 29 02:27:41 2020 No.17145069 >>17145042 Fuck nietzsche he was a dumb incel loser

>>	Anonymous Tue Dec 29 02:49:44 2020 No.17145168 File: 12 KB, 236x340, B627E1A8-F3A9-420A-A566-99C3B9E502C0.jpg [View same] [iqdb] [saucenao] [google] >>17145042 >*blocks path

>>	Anonymous Tue Dec 29 02:56:09 2020 No.17145204 >>17145168 >pbuh

>>	Anonymous Tue Dec 29 02:59:34 2020 No.17145225 File: 87 KB, 555x781, 1609166449104(1).jpg [View same] [iqdb] [saucenao] [google] >>17145042

>>	Anonymous Tue Dec 29 03:23:53 2020 No.17145343 >>17145042 >>17145069 >>17145225 Black hands typed these posts

>>	Anonymous Tue Dec 29 04:47:48 2020 No.17145687 explain the meme of doing “philosophy” through sci-fi horror fiction, please.

>>	Nick Land Tue Dec 29 09:20:02 2020 No.17146779 >>17144230 Fuck you

Advanced search
Text to find
Subject [?]Search by post subject. Leave empty for any.
Username [?]Search for user name. Leave empty for any user name.
Tripcode [?]Search for tripcode. Leave empty for any.
Email [?]Search by email. Leave empty for any.
Filename [?]Search by image filename. Leave empty for any.
From Date [?]Enter what date to start searching from. Format is YYYY-MM-DD
To Date [?]Enter what date to start searching until. Format is YYYY-MM-DD
Image hash
Search in	All Posts OPs Only
Deleted posts	Show all posts Show only deleted posts Only show non-deleted posts
Internal posts	Show all posts Show only internal posts Show only archived posts
Order	New posts first Old posts first
Capcode	All Posts Only by Users Only by Mods Only by Admins Only by Developers
Results	Posts Threads
Action	[ Simple ]