/lit/ - Literature

Stoicism and epicureanism
google it for an introduction

>>16068108
Just go cold turkey

>>16068154
I wouldn’t say this. I thinks it’s better to ween yourself off it. That being said , the exception is video porn, which should be stopped immediately, it’s like coom heroin

>>16068108
>my fetishes have gotten more and more abnormal as time has gone by.
Do elaborate. I've been doing the same and the most extreme I've gone is some tranny porn I've watched a couple of times over the past several years. Other than that, anal is the most "hardcore" I've been into for a large period of time, but it's been the new vanilla for a time now.

>>16068108
OP, stuff like scat is extreme, other than that, you're a normalfag. I'm not saying it's a good thing, but don't think you're an anomally

I just busted a huge nut to 30 tabs of alternating venuses and lolis. Don't give 2 fucks what the moralfags on this board think.

>>16068108
Holy shit I haven't seen pic related in a long time

>>16068240
>venuses
The patrician’s /d/ thread

>>16068170
>the exception is video porn, which should be stopped immediately, it’s like coom heroin
How come?

>>16068263
Because with static pics you still have to use your imagination a bit. Video eliminates any effort on your part, it's the easiest kind of porn to get addicted to.

>>16068123
Thank you.

>>16068154
I've tried, but as mentioned in the OP if I go too long without it my mind ends up becoming clouded.
I become unable to think normally with constant thoughts of sex, and rub one out to clear my head, typically resorting to one of my unfavorable fetishes given my mental state.

>>16068203
I think I'm most dissatisfied with my fetish for transformation.
In case it wasn't apparent by my mention of "art" in OP, and my corresponding image, I don't really masturbate to 3D videos, only doujins and individual drawings.
Because of the lack of restrictions of 2D, the existential and body horror of fetishes, particularly transformation, can be significant, and I've gone down that path.
As an example; a girl turned into a mannequin, still conscious but entirely unable to move, is mistaken as one of the store's stock, and used as an ordinary mannequin in spite of her ability to still see, hear, and think. She is treated is an inanimate object for the rest of time.
Shit like that makes me incredibly aroused when already somewhat aroused, but when lucid I absolutely abhor it.
There are other examples, but I feel that one suffices.

>>16068233
What about body horror and existential horror, as I mentioned bellow your post?

>>16068286
You might be repressed, man. I can't understand your fetish, but I don't think it's disgusting or you should feel bad for it. Embrace your sexuality, but learn to control it if you don't feel comfortable with fapping so much.

>>16068336
How am I repressed if I only feel aroused by the fetish when already aroused, but feel nothing but contempt for it under normal circumstances?
I don't particularly feel comfortable fapping to it at all, and I used to fap to it all the time.

>>16068286

I would recommend patience and meditation.

Also fasting.

You can see you've managed to improve drastically, be satisfied with gradual improvement and will yourself to keep at it.

If you can will yourself to not eat for several days, that proves you can will yourself off something like internet porn.

>>16068299
The mannequin example doesen't really seem that odd. OP, you still have a chance to go back (not in the isulting sense of going to other sites), that stuff is still normal. Just get that stuff out of your mind, by seeking to stop it you are already miles ahead of a lot of people. Plus, the fact that you "abhor" such a trivial scenario speaks well of you and your intentions. You can do it OP!

>>16068344
I appreciate the sentiment on visible improvement, and have considered fasting. However I have a remarkably high metabolism as well as autonomic issues. Given I often travel to different levels of my house, I'd be afraid of fainting and injuring myself if I were to fast more than a day.

>>16068343
Precisely because you feel contempt to it when not aroused is that you are repressed, my man.

>>16068371

Oh, start at a day, give yourself several weeks in between fasts, and work up to 36 hours, 48 hours, etc. Only as you feel comfortable at each stage.

That's how I did it, thought I don't have any disease. However this last year I did my longest (7-day fast) and basically since then have quit internet porn and masturbation entirely.

I 'struggled' with quitting internet porn (into hentai /d/ stuff) for ~5 years with marked improvements along the way. After my 7 day fast I have completely quit for ~5 months, with no real urges.

>>16068374
Wouldn't that imply that the "normal" state for the mind would be arousal?
While I acknowledge arousal as a natural state for the mind, I do not acknowledge it as the natural state of the mind. Thus feelings felt during arousal that are contradictory to those felt under normal conditions are the ones that are.
Unless you are suggesting it is preferably to fall to general basal desires, which is a form of hedonism that I reject from experience.

>>16068359
To elaborate, existential torment and body horror are very negative topics that live up to the "horror" designation. While interesting as thought pieces, very few would "enjoy" them or take happiness from the character's suffering if the character has not been established to deserve their fate. Despite this being my sentiment when not aroused, when aroused I do in fact take pleasure and attain arousal from the character's suffering.
The mannequin example is just a commonly used example. For a better example of the train of thought, while I do not find it arousing as it is not presented in such a manner, see it like getting off to the ending of I Have No Mouth Yet I Must Scream.

https://pmohackbook.org/
It's based on some method on cigarettes addiction, haven't tried it.

I had some fucked up fetishes too, but decided to quit couple months ago and now just watch some erotica, gradually want to eliminate it entirely.
I had been trying to quit earlier but failed. I think the fetishes were based on low self esteem and relief of high stress, which I'm now free of.

There is a kurzgesagt video on addiction, I know they're shit propaganda and poor research but this one gives the idea on one of the aspects of addiction.

>>16068240
Holy based.

Matthew 5:30

>>16068108
Your Brain on Porn is a good start. I'd reccomend quitting porn and abstaining from masturbation for the time being. It's going to be tough at first but this is to get you out of the thick of things. Then I would suggest journaling as well as some meditative practice so that you can get to the source of the fetish. I had a particularly embarrassing kink that has seriously atrophied as the result of the methods I suggest. The journaling especially helped me understand where it came from and why it's harmful. Good luck OP, if I can so can you.

>>16068530
>Jesus literally yells them to cut their hand
>H-He didn't mean it literally it was just hyperbole!
Do christfags really...?

Muzak: https://www.youtube.com/watch?v=GNjStWG2vLU

>>16068108
Addiction is a retarded term. The fetish IS the addiction, too many people are just uncomfortable standing their ground and admitting to what their fetish actually is.

I guess in this context a fetish would be: SHIT THAT EMBARRASSED THIS IMMORTAL! As in even on an eternal scale they find coping with it sometimes difficult.

Everything can be resolved through ritualization and rhetoric!

You are either taming your orgasm or taming how the universe translates it to, and for, you. I obviously am the master of the latter and most beginners find themselves, quite happily, in the field of taming their own orgasm.

The fetish however never really goes away, if it does that is usually what we call ego death because the central pillar of communication/language/story that you interacted with detached from your spirit and all the basic happy connections (or largest number of happy connections) all experience a chemical sense of loss. The rebalance of such neural slash n' burn practices is what makes people go 'muh existential crisis' when the truth is when you've had one you've had them all.

That's the cringe about spirituality and religion that I personally can't stand. They fetishize the existential crisis, which actually prolongs whatever cultural problem it is masking or acting as a band-aid for. My fetish is simply communication and effective rules of engagement and memory attachment/detachment, with preferred intensity vectors respected. That way all people I communicate with have some sort of 'exponential ejection trajectory' for having stumbled upon my private dimension of totally cool shit, all the time.

>Aboriginal Elder, KumKum the Kookaburra ~Courtesy of Dhinawan's Breast, Nest, and Test~

=0

One of my student's presentations: https://www.youtube.com/watch?v=F_WOlvyXrNo

Her thesis is essentially on fetishism, self-determination, integrity, and their helpful communal practices.

>>16068587
This post hardly constitutes English.

>>16068629
If the constitution of your own interpreter or language abstraction method is so weak that you have to spit out your 'I reject data point presented' instead of something constructive then perhaps drink more water?

>>16068636
This reads like a fucking bot.

>>16068645
How presumptuous are your directions?

>>16068636
this post has no sense
take your meds

>>16068661
That was the 'drink more water' prediction I made. Don't mind me, I'm just a meta-baiter.

>>16068666

>>16068108
lmao pic related made me cringe so hard

>>16068479
>>16068563
Thank you both for these, will check them out.

>>16068530
Nobody cares.

>>16068754
Matthew 5:5 + 1 "Blessed are the patient, for they who were the meek were waiting for."

>>16068108
Stop watching porn, cold turkey and FOREVER. That alone will do it.

>>16068865
But then how will I ever fool myself or be fooled by others?

>>16068530
This.

>>16068108
>Having been on 4chan since '08, I've fapped a fair bit too frequently and my fetishes have gotten more and more abnormal as time has gone by.
>Over the past two years, however, I've grown a very lucid disgust with what turns me on, and disdain for sex in general.
I get turned on by some truly cringeworthy shit, but I found that it's a totally different sensation to the one I get when a girl I like is near me and arousing me. The latter scenario feels a lot more natural, like the motions I'm making with my hands and lips are instinctive. When I watch the porn I've been seeing since I was a kid I just sort of glaze over and start to fap. To be honest, it's worrying me too because I'm consciously aware of the way the porn is reinforcing itself, and reshaping my young brain. I really need to stop before it's too late.

>>16068718
Yeah because you're a whore that took cock of every color fifty times over

>>16069260
So wise are you in the ways of penile accounting and its practices, pray tell Master, what is thine secret?

Quitting porn has been one of the best decisions of my life

>>16069265
Because that's when porn becomes YOU!

>>16068718
>cringe cringe zoomie zoom zoomies
What about it do you dislike, out of curiosity?

>>16068108
Your Brain on Porn
The Porn Myth
Wired for Intimacy

You're welcome anon

>>16069410
https://www.youtube.com/watch?v=CdAZ79AhcfY

Hentai forever bitches

>>16069471
I would argue more that production of fetish items and languages are important for human anything really.
>I just say yes to everything because having to hear or even use no is a drag on my time and resources. Oi! Everyone! Use my time more effectively!

>>16068240
Godspeed you retard, I love thee

>>16069410
Thank you very much.

>>16068108
Far left is the best

>>16068530
based

>>16068108
https://pmohackbook.org/

To OP, and other 'depraved' anons,

Fetishism and supposedly "abnormal" or "deviant" sexuality usually has two primary consequences: either one feels worrying physical consequences after the activity (i-e the development of obstructive hypersexuality, loss of sensitivity etc.) which are actual medical concerns, or the conflation of one's sexuality with a supposed "degeneracy".

The latter seems to be the most common, and I'd argue that these latter cases dwarf the cases discussed in anti-pornographic studies by a big margin. It seems the medieval dogmas irrevocably persist even today, as does the overwhelming curse Christianity and "moral tradition" has placed on sexuality in gender.

Despite the fact that masturbation and porn have been increasingly normalized, there is still a very palpable taboo and guilt present in all those consuming it; as evident in your post, OP. You've just stigmatized to your own urges.

Accept your fetishism. Accept your porn watching. Accept your need to jerk off to mannequins and existential horror. Stop feeling disgusted about feeling disgusted in your fetishes. A fetish doesn't turn you on right this moment? Don't indulge in it. A fetish does turn you on this moment? Do indulge in it. Masturbation should be equivalent to taking a piss (scat jokes aside), in that it's unavoidable and not ruminate upon. Don't talk for the stoicism and regression memes.

Fetish escalation is a real thing. If you feel the need to turn back to vanilla, decondition yourself for a bit by avoiding related material. If you feel like you're engaging with porn longer than you want to, monitor your use. If you feel yourself developing actual physical problems such as the ones mentioned before, cut down until your reach where you want to reach.

The fact is you wanted to and made the conscious choice to read doujins. You felt the urge and you sated it. Stop overthinking.

>>16070773
i feel like strangling you but that doesn't mean it's a very good idea

>>16070773
Why fetishes are worrying is because they are self evidently unnatural in a way that actually effects a person. A kid wouldn't be sexual attracted to Anthropomorphic Futas unless he has seen it somewhere or at least exposed to the idea or an idea adjacent to it and got aroused thus leading him into a lifestyle that is the result of the sexual desires. For example, splurging thousands of dollars on fursuits and art without practical benefit to any of it other than community. I would even argue that he knows it is unnatural and becomes mentally cannibalistic of his own behaviors despite being coddled and lead to believe it is natural and normal by the himself and the society around him. I think this is the reality of current porn addicts, as sources for enabling and minimizing the effects of the behavior is abundant. And it can also be said that If he hadn't discovered the same fetishes, he might lead a relatively normal life with a normal sex life and live relatively happily or at least without the added baggage of being sexually obsessed with a thing that controls his life and behavior.

>>16070373
This is written like dogshit

>>16068263
I stopped watching video porn for the same reason I only buy free range or sustainably caught meat, the same reason I only ship through Amazon if I have no other choice. It's an exploitative industry, and I don't want to support it or consume its product.

>>16070832
it's even more painful if you can actually see and feel the progress of your sexual attraction and the existence of a gradient itself is an abhorrent atrocity to the psyche of a man. The fact that years ago you can jerk it to simply two humans being intimate to only being aroused by two ponies sucking eachother's cock is a horrifying image.

>>16068457
Repulsion and sexual attraction are two wires frequently crossed. I have a good friend who's into vore, which, as I understand it, started from a sort of "can't look away" horror at nature documentary scenes of animals being picked off from a herd and eaten while the safe group members look on.

>>16070936
>be exposed to porn and become aroused
>feel disgusted afterwards
>after many sessions disgust is associated with arousal
>become attracted to something you found disgusting
Many such cases t. guy with a laundry list of fetishes

>>16068479
>>16068108
This is the only method that has worked for me.Dont listen to the people in this thread advising you to cut down consumption.Porn is like any drug ,you either are addicted or not ,in fact its much easier to quit told turkey ,with a porn fast youre just torturing yourself.And as soon as you stop porn completly those fetishes will start to go away.

>>16068108

>>16068263
It's not. If you read regularly you can wank to written smut with equal ease, or at least on the assumption you can read with one hand (I've never bought paperback porn). I'll use handfulls of paragraphs for weeks, and it isn't as if using "more of my brain" decreases the depravity, and since I can read well, the frequency isn't altered either.

Maybe worry less about the depravity, and more about whether the fetishes are even your own as opposed to the product of influence and marketing. It is probably more a matter of your Wifi, the medium of communication, than the footage/drawings/words/whatever your preferred medium of consumption is. Just turn your Wifi off. You'll find that when something does not have to grab your attention, it won't have to be so over the top, but at the same time you'll have more freedom to use over the top things in a less commercially-forced or fetishized sense. Read or write about a fetish you don't like if you really want to see what fetishization is, independent of fetishes. It has little to do with what's being fetishized; you can have a fetish for tradwives, chastity, etc and it's still a fetish.

>>16071434
That's actually a solid experiment though. Completely inhumane, but if you can change a cis person's genitals to induce dysphoria, it's evidence of at least pre-genital gender.

>>16070832
>For example, splurging thousands of dollars on fursuits and art without practical benefit to any of it other than community
Community is important though

pictures-hitler-in-color-24>>16071590
>pre-genital gender.
It's called sex, unless we are talking about grammar.

>>16071696
see >>16071434
>history of gender

>>16071701
Gender is a fake term made up by a mentally ill pedo. There is sex and it is determined by sex chromosomes, bar for rare cases of sex chromosome mutations.
"Pre-genital gender" as you call it, is nothing but sex.

>>16068108
Ive never had my masturbation get really perverted, luckily as it was bad ages ago, but yeab the common remedy is, and im going to be the lame guy for saying it, nofap. Lots of people have confirmed it, it just rewires you sexually. Also if you dont want that try psychedelics they similarioy reset your brain, although more violently and if your not mentally stable, ie depressed anxious or sexually perverted, wouldnt recommend it, can be prone to a bad trip

>>16071713
>There is sex and it is determined by sex chromosomes,
Except that's false. First because of the counterexample you already gave (as if that makes it not a counterexample), but second, because chromosomes are not observable by naked eye. Zero people are chromosomesexuals. They observe other properties, which rules out chromosomes, and similarly we have ruled out genitals.

>>16070238
You read it right to left retard. Its a positive linear progression where she becomes more conservatively dressed.
Is this even an anime image board anymore?

>>16071727
It's not a counterexample unless you are literally retarded. I've got nothing to say to you no more, except restate my position: sex is determined by sex chromosomes at conception. Cases of genetic mutations in sex chromosomes are to be determined as non-sexuals and thrown in the oven. The word "gender" is only relevant to grammar and always will be.

>>16071747
>I've got nothing to say to you no more, except restate my position
Yeah, because all you have is a position, and not an argument or foundation.

Zero animals on the planet have been attracted to a mate by chromosome. You have no examples of this and the burden of proof is in your court. A gay man is not attracted to the shape of XY: he is attracted to "men." Someone attracted to women is not attracted to XX but "women." They see only external properties, which coalesce into a form of gender. Chromosomes are not included in this loop, and genitals are by a wide margin the most censored and concealed human body part. Show children a statue of David and guess where the leaf is.

>>16071737
I know how the image works you dumb ass. I'm providing a contrary opinion that suggests I find her original state more attractive. Learn how to read between the lines, you ESL.

>>16071785
Sex is determined by chromosomes but overwhelmingly correlated with secondary sexual characteristics like breasts or broad shoulders. What is your point anon?

>>16071785
>Zero animals on the planet have been attracted to a mate by chromosome.
Hate to break it to you, but mating with individuals with wrong chromosomes does not produce babies, ergo those animals who can't "detect" chromosomes, don't survive. Natural selection ensures that only animals which have the best ability to "detect" chromosomes proliferate their genes. On the other side, there is evolutionary pressure to "show off" your chromosomes as best as possible, it's called sexual dimorphy.
>gay man
There is no such thing as a gay man (as in: born gay). It's a fetish/perversion.
>external properties
The correlation of "external properties" with chromosomes is more than 0.99.
>genitals
If you can't tell a man from a woman without pulling their pants off, you need to get your eyes checked.

>>16071796
>far left is the best
>her original state
Lol retard

>>16071785
you fucking retard. The outward appearance is the gauging of the condition of your genetics. How can you literally cherry pick biology and natural attraction? A man is not attracted to a woman because of her features, and her features are the result of her genetic makeup and ie chromosomes. That's why people with genetic chromosome mutation are ugly as fuck or at least undesirable to the opposite sex in terms of appearance. Nowadays, science has progress to synthetically produce the hormones that they cannot themselves reproduce thus able to replicate the appearance of born male or female. This does not however excuse the act of transgenderism and hormone therapy itself because that's another debate. Fuck off with your stupid feminist theory.

>>16071818
>homosexuality is a fetish
Lol ok, you gay retard. Trash opinion.

>>16071797
Wrong. Let me put fix those words in the right order.

>Gender is determined by external characteristics, which generally correlates with chromosomes.

>>16071828
>A man is attracted to a woman because of her features
woops typoz hehe

>>16071829
It's not an opinion, it is a fact. Can you refute?
What if I told you that Romans who fucked each other in the ass, also had wifes and children at home? Do they constitute homosexuals?

>>16071818
>Hate to break it to you, but mating with individuals with wrong chromosomes does not produce babies, ergo those animals who can't "detect" chromosomes, don't survive.
So? Animals that don't breathe air don't survive. That doesn't mean they have ever seen air in their life.

>If you can't tell a man from a woman without pulling their pants off, you need to get your eyes checked.
Bet you've been fooled.

>>16071835
I didn't use those words.

>>16071828
>is the gauging of the condition of your genetics.
>Hmmm yeah look at that guy I bet his genetics loot like AGTCCTGACATGATCGTTTCTCAG

>>16071821
Whoops upon rereading my post I see that I had actually said left instead of right. How silly of me.

>>16071847
That was your mistake. I used the word gender, since the first post of mine you replied to.

>>16071835
Wrong.

Gender is determined by whatever's in the dictionary, as it is nothing more than a grammatic attribute. As long as we are talking about sexually-reproducing animals, there is only sex.

>>16071851
yes you fucking dipshit. That's how attraction works. What, you want another reason? For their "beauty"? what constitute beauty then? Why are there general consensus regarding beauty? What is beauty and why are fitter people more attractive? You fucking dimwit shallow nincompoop.

>>16071865
OK, so we just have to wait for the dictionary to virtue signal and then the argument will be concluded. It'll happen soon enough, anon.

>>16071867
>I'm so deep I see peoples genetic code
lmao

Only a person's final properties exist within the sphere of mating. Anything short of that is not gender or something to which an individual may be attracted.

>>16071877
If a man """""mates""""" with a transgender woman (AKA a sexual man who cut off his penis, took hormones, and pretends to be a girl), there will be no progeny. In other words, that man's genes will not survive.
Therefore, only men with "supernatural" (according to you) ability of reading into someone's "AGTCCTGACATGATCGTTTCTCAG" (as you called it), will spread their genes further.

Nature be the final judge.

>>16071877
I am not deep you retard that's how attraction works. You just refuse to accept it because you have invest so much time on garbage literature that your brain has accepted as truth. The fact is trans people are easily identifiable because of this. The existence of gradient doesn't automatically justify the deconstruction of the concept.

>>16071877
>I'm so deep I see peoples genetic code
You can too retard. Everyone can. That's what we inadvertently gauge when we find people attractive.

>>16068240
king

>>16071899
>In other words, that man's genes will not survive.
Wrong. Plenty of things exist and recur without genetic progeny. If you understood you were not simply looking at genes, you would understand this.

>>16071908
>I am not deep
clearly

>The existence of gradient doesn't automatically justify the deconstruction of the concept.
What am I deconstructing? I'm saying gender "is." You are saying gender "is not."

>>16071908
It's the same type of post-structuralism that made Foucalt die of faggot-AIDS. Similarly, that guy (and many others like him) will fail die after failing to procreate. Nature doesn't read books.

>>16071923
Do you work for the human genome project?

>>16071944
>will fail die
will die*

>>16071940
>Plenty of things exist and recur without genetic progeny.
True. Pic related.

>if we reproduce fast enough we will still exist in 100 years
Well I suppose that tactic has worked for the poor

>>16068108

https://pmohackbook.org/easypeasy.pdf

https://pmohackbook.org/easypeasy.pdf

https://pmohackbook.org/easypeasy.pdf

No idea how this hasn't been posted yet. /fit/ every now and again strikes gold. This is one of the few good things that I found lurking their daily /nofap/ threads. In summary the biggest challenge to overcome is your mindset. The biggest pill to swallow is that you are deluding yourself that you 'need' porn at all to be happy. That giving it up mean you are 'losing' out on something rather than gaining. Don't be so hard on yourself and enjoy life a little more. You just have to see the world beyond the end of your dick. I mean this quite sincerely but learning to ween yourself of the internet (and 4channel) will actually do you a load of good too. The other tough pill to swallow.

>>16071963
Surely you know how to press CTRL + F?
>>16068479
>>16070373

>>16071954
>True.
So, you admit you were wrong? After all, if transgenders don't reproduce, and yet exist, that's an example of genetic progeny not being essential for existence.

>>16071940
I'm saying gender and sex is the same and the differentiation between the two is an attempt at validating the trans community and invalidating cis people. And me not being deep is clear, but you are being purposely facetious and obscurantist to get your point across without substantial philosophical backing which is fair enough, but it doesn't prove me wrong.

>>16071998
I assume your browser doesn't show images. That's unfortunate, as you are browsing an anime imageboard.

>>16072003
I'm not. You're the one attempting to remove a word, a word which I am using to replace nothing. You're the obscurantist, objectively.

>>16072006
I assume your browser doesn't show sentences. That's unfortunate, because it caused you to miss the argument.

>NOOOO WHAT IF MY WIFE IS WRITTEN IN PYTHON INSTEAD OF JAVA
Thinking gender and sex are the same is as retarded as equating color and wavelength. Only a philosophically inept person would do this.

>>16072011
I'm not removing any word. They are interchangeable. You are intending to remove some concepts away from each word to fit different niches to validate your stance.

>>16072026
i shouldn't say "you" that's my criticism towards the concept of the differentiation again. Sorry, my conjecture. I just don't agree with the presupposition in the first place, so points can't really clash properly.

>>16072025
>>NOOOO WHAT IF MY WIFE IS WRITTEN IN PYTHON INSTEAD OF JAVA
This is the most retarded thing I've ever read.

>>16072026
>he doesn't even know the difference between words and their symbols
lmao

>You are intending to remove some concepts
What have I removed from the word "sex"? The only possible example is relation to the word gender, a word which according to >>16071713, is not actually a word but "fake," in turn meaning no, I have not removed any part of your language.

>>16072069
>is relation
is its relation

>>16072051
more like you've been blown the fuck out

>>16072025
>python
>java
Anyone who's not written in pure HolyC goes into oven.

>>16072025
you can tell whether it's in python or java by how sharp their jaws are and how broad their bodies are kek

>>16072095
Though actually, you can't

>>16072069
>he doesn't even know the difference between words and their symbols
the words and their symbols are symbiotically connected. I don't know what point this is trying to achieve. I concede that it means two different things nowadays. My contentions is with the synthesis of the paradigm in it's inception.

>>16072101
Those who can, win. Those who can't, lose. As I've said before, Mother Nature does not read books, and certainly not post-structuralists.

>>16072101
yes you can bruh if they fooled me, then they actively covered it up or the hormone therapy has shifted their features to obscure it. In majority of cases, you can absolutely identify the remnants of their previous sex. If not, that's great for them.

>>16068108
>still dresses like a whore

>>16072103
>the words and their symbols are symbiotically connected
Yeah, you don't know what any of these words mean.

>My contentions is with the synthesis of the paradigm in it's inception.
Oh man you are really trying.

If you remove the-word gender that I am using, you are removing a word; that you still use they symbol "gender" or still have homonymns to the word which I have used, does not mean you have used the word I have. >>16072003/>>16072026 remove words. You should learn what words are before talking so much about them. A different meaning is a different word.


>>16072108
Then why do they keep winning?

>>16072133
>they symbol
the symbol

>>16072133
>A different meaning is a different word.
yes? I agree? Maybe I'm wording my words badly? I told you that our presupposition of the word itself is different therefore point can't clash because we're using different definitions for the same word.

>>16072133
>Then why do they keep winning?
By Allah, if you call 40% suicide rate winning, I'll shoot myself in the head right now.

>>16072163
40% suicide rate and yet somehow a growing population, interesting

>>16072167
the problem solve itself.

>>16072172
By their population increasing?

>>16072163
>I'll shoot myself in the head right now
do you not see the irony here

>>16072179
>>16072186
i don't know how you can't see the correlation here.

>>16072197
Growth correlates with dying? What? They see population growth and it's shown despite their suicide rate. Growth means their population is getting bigger. Three minus one is two, not "minus one."

>>16072232
Lol the rate of growth is higher that the rate of suicide you idiot. It's more like 50 - 20 = 30.

>>16072321
but yes sure of course a society that is fostering people with your ideology is not also the society that is fostering the condition of suicide. Yes sure.

>>16072025
>coding analogy

yep, its agp

>coomer fetish thread turns into a trans debate
Like poetry, this place really is irredeemable.

>>16072025
Thanks for a peek at tranny mental gymnastics.
(light with a 650nm wavelength will always be red btw)

>>16072535
>/lit/-Literature
lmao

>>16072535
Should have contributed