/07/th Expansion Thread

[Anonymous No.]

Discussion concerning Higurashi, Umineko, Ciconia, Rose Guns Days, Higanbana, TRianThology, Haworthia and all other 07th Expansion works.

07th Expansion archive:
https://mega.nz/folder/wLxAFApJ#bw2evoJRzl6BDhlpadX1YQ
(Dead at the moment, backup torrent(?) soon)

Umineko colored truths script:
https://controlc.com/27143a5a

Scorpion Charm:
https://pastebin.com/aa9NjGdU

Image-Based Scorpion Charm:
https://pastebin.com/G5xm1rbQ

Previous Thread: >>36420800

[Anonymous No.]

>>36443598
god

[Anonymous No.]

>>36443598
Why would you make a new thread while the old one is still up you fucking moron?

[Anonymous No.]

Can someone link an unpatched version of Saku?

[Anonymous No.]

>>36443759
Sure here you go lol
http://www.lemonparty.tv/

[Anonymous No.]

>>36443779
thanks

[Anonymous No.]

>>36443598
Is that ona for Satoko?

[Anonymous No.]

Fuck me.
I go away for like 6 mths
and when I come back
YOU FAGS ARE STILL HERE

[Anonymous No.]

>>36444403
bye

[Anonymous No.]

>>36444403
>Fuck me.
Ew, no thanks.

[Anonymous No.]

>>36444403
Suicide is the only way to escape from here anon.

[Anonymous No.]

beato paizuri

[Anonymous No.]

Previews are up.

[Anonymous No.]

bored

[Anonymous No.]

[Anonymous No.]

>>36444486
This looks like it could be edited to be more erotic.

[Anonymous No.]

[Anonymous No.]

[Anonymous No.]

no chink leaks allowed!

[Anonymous No.]

>>36444488
This is probably a flashback to baby Rika.

[Anonymous No.]

>>36444528
This is the chinese century, comrade. Better start learning Mandarin.

[Anonymous No.]

>>36444528
Why did the jannoids feel the need to delete this anons post?

[Anonymous No.]

>>36444552
probably because they didn't, rather, he deleted it himself after realizing that these weren't chink leaks.

[Anonymous No.]

>>36444486
>>36444488

[Anonymous No.]

[Anonymous No.]

Is there any chance the Mega archive will be revived?

[Anonymous No.]

>>36444720
No, It's over

[Anonymous No.]

>witches are just copetards
HOW WILL MAGIC KEKS EVER RECOVER?!?!?1

[Anonymous No.]

>>36444823
We can't.... We fucking can't okay!...

[Anonymous No.]

Rika be like

[Anonymous No.]

>>36444853
wtf

[Anonymous No.]

>>36444853
KEK XD I REALLY REALLY LOVED HOW YOU POSTED THE SAME EXACT POST IN THE LAST THREAD XD YOU SHOULD MAKE THIS THE /07/ RITUAL POST XDDD JUST LIKE /a/!!!!!

[Anonymous No.]

she cute

[Anonymous No.]

>>36444893
she looks like she fucks the edges of tables

[Anonymous No.]

>>36444893
Yes! She is!

[Anonymous No.]

eh
is this wow wow thing something that all arab girls say?

[Anonymous No.]

>>36444893
yes.

[Anonymous No.]

Dlanor is cute! CUTE!

[Anonymous No.]

Day 52 of praying for RGD adaptation.

[Anonymous No.]

>>36444488
This is teh Umineko mansion staircase guys

[Anonymous No.]

>>36444907
Only the cute ones!

[Anonymous No.]

Do you guys ever have a theory that sounds cool on your head but seems kinda silly when you write it out?

[Anonymous No.]

>>36444970
theories are cringe.

[Anonymous No.]

>>36444970
post it anon I want to see your ciconia theory

[Anonymous No.]

>>36444970
Not but I wish everyone felt that because most WTC theories suck so bad

[Anonymous No.]

>>36444970
Don't worry anon, That's normal. When writing a lot you may feel a whole lot of cringe over what you've just written down. When you feel like that take a break and let it stew for a bit while reflecting on the purpose of your writings. I just want you to know I'll read it even if you think it's cringe.

[Anonymous No.]

>>36444486
she looks like Frieza...

[Anonymous No.]

>>36444994
I'll probably post it tomorrow after I've had a chance to proofread a bit.

[Anonymous No.]

>>36444823
>M-MAGIC IS REAL, I'M NOT COPING!!!!

[Anonymous No.]

>Akasaka and Takano in previews
Uhhh what?

[Anonymous No.]

>>36445311
Akasaka and the Satoko shot are clearly from Neko's first world. The confusing part is Takano. Maybe she's part of a large flashback from Hanyuu about Rika's life?

[Anonymous No.]

Tomita -> Tomitake
Okamura -> Akasaka

[Anonymous No.]

>>36445361
wow haven't seen this mentioned 50 times before or anything.

[Anonymous No.]

[Anonymous No.]

>>36445383
I hate to see them portrayed as friends, it feels completely dishonest to their character arcs and makes light of Rika's suffering.

[Anonymous No.]

>>36445448
Except Sotsugou doesn't happen in Mei.

[Anonymous No.]

>>36445448
without love it ca

[Anonymous No.]

>>36445464
My guy, it literally doesn't matter. We now know what kind of person Satoko truly is and I hate to see her act all affectionate towards Rika.
It's the same as Kyrie calling Battler a good boy in one game while contemplating to brutally kill him in the next one.

[Anonymous No.]

>>36445531
Satoko isn't like that from the get go, she becomes like that after certain events in Gou, namely her bad experience at St Lucia and Eua turning her into a looper. These events don't happen in Mei. In fact, Mei's version of St Lucia has Rika stay close to her all the time, so Satoko stays happy.

[Anonymous No.]

I dislike both Rika and Satoko

[Anonymous No.]

>>36445624
https://www.youtube.com/watch?v=5hR5YNqE3K8

[Anonymous No.]

>>36445639
Mad

[Anonymous No.]

>>36443598
Uuuuuuuuuuuuuuuuooooooooooooooooooooooh

[Anonymous No.]

>>36445555
Satoko was pretty eager to kill Rika in her first loop though.

[Anonymous No.]

>>36444994
don't post it anon you might get laughed at

[Anonymous No.]

Don't we have an archive?

[Anonymous No.]

>>36444403
It's horrible, the only good thing here is mysteries, well actually they're not even HERE

[Anonymous No.]

I just woke up from a dream where I struck a chuuni pose, shouted an incantation and then Lambdadelta's breasts grew very large. Afterwards she gave me a clothed paizuri and her chest returned to its original size

[Anonymous No.]

>>36445824
That wasn't a dream

[Anonymous No.]

>>36445832
That would mean that I have real magic powers.

[Anonymous No.]

magic is not real

[Anonymous No.]

magic is real

[Anonymous No.]

not magic isn't unreal

[Anonymous No.]

magic is real if you believe in it

[Anonymous No.]

Do you think there's no loop in which Takano could check for missing h173 samples?

[Anonymous No.]

>>36446062
dunno but I wish there was a loop where she gave me a handjob.

[Anonymous No.]

>>36446072
Don't we all

[Anonymous No.]

I'm bored. Tell me what to draw.

[Anonymous No.]

>>36446123
Ange, Shion and JK Satoko at a bar, depressed.

[Anonymous No.]

>>36446123
Patchouli and Mion kissing each other

[Anonymous No.]

>>36446123
satoko footjobbing me

[Anonymous No.]

>>36446123
Frederica Bernkastel saving Gousotsu

[Anonymous No.]

I'm bored. Tell me what to do with my life.

[Anonymous No.]

>>36444486
Eua getting ready for that cumshot

[Anonymous No.]

>>36446191
Draw porn

[Anonymous No.]

>>36446191
learn to draw so you can draw for us.

[Anonymous No.]

>>36446128

[Anonymous No.]

>>36446201
Thanks.

[Anonymous No.]

>>36446123
Rika secretly using the St. Lucia money for shady breast-enlargement treatments.

[Anonymous No.]

>>36446123
Sakutaro and Lucifer in bed

[Anonymous No.]

I'm bored. Tell me what to do with my wife Hanyuu.

[Anonymous No.]

>>36446224
Give her to me so I can sink her head in with a hammer.

[Anonymous No.]

>>36446224
play with her feet

[Anonymous No.]

>>36446138

[Anonymous No.]

>>36446291
wtf cute good job

[Anonymous No.]

>>36446291
They are supposed to be kissing each other. But this is cuter.

[Anonymous No.]

>>36444478
Oh it's this.

[Anonymous No.]

>>36446363
Yeah, I'm glad all my Satocoins were sold in january.
There are some poor folks now, lads.

[Anonymous No.]

So are they really gonna waste time on Nekodamashi loops? With 4 episodes left?

[Anonymous No.]

>>36446406
Duh, what are they supposed to do, skip them? If they didn't skip the other damashis, they won't skip this one.

[Anonymous No.]

>>36446406
Well yeah, we'll end on Nekodamashi 5 and continue next season.

[Anonymous No.]

>>36446414
Sort of? Do we need to know the specifics of how Satoko injected Kimiyoshi? Do we need to see her put on an evil smile and witch eyes for the 675th time?

[Anonymous No.]

>>36446148

[Anonymous No.]

>>36446430
Again, if we didn't skip the previous damashis we're not skipping this one, period.

[Anonymous No.]

>>36446148
With text

[Anonymous No.]

>>36446426
Gou season 3: golf holes

[Anonymous No.]

>>36446432
>>36446441
nice

[Anonymous No.]

[Anonymous No.]

>>36446432
>>36446441
Bejita...

[Anonymous No.]

Let's begin this fragment with a positive vibe

[Anonymous No.]

>>36446447
Who's playing golf?

[Anonymous No.]

>>36446466
>over 100 posts in
Dumb Beatranny

[Anonymous No.]

>>36444488

[Anonymous No.]

>>36446426
I don't like the idea putting a whole season of needless padding in the middle.

[Anonymous No.]

[Anonymous No.]

>>36444506

[Anonymous No.]

>>36446471
Please no bullying, I was out late last night

[Anonymous No.]

[Anonymous No.]

[Anonymous No.]

>>36446166

[Anonymous No.]

>>36446535
Based.

[Anonymous No.]

How can r07 save Sotsugou?

[Anonymous No.]

>>36446547
Slapping Satoko

[Anonymous No.]

>>36446553
That'd be a terrible resolution.

[Anonymous No.]

>>36446547
It doesn't need to be saved

[Anonymous No.]

>>36446502
Looks like you have to calm down your autistic daughter, Rika, she's doing that hand flapping thing again

[Anonymous No.]

>>36446547
Introduce Tamurahime no Mikoto

[Anonymous No.]

>>36446547
Hardcore lesbian sex.

[Anonymous No.]

>>36446561
I dun play touhou

[Anonymous No.]

>>36446502
Rika has parkinsons!

[Anonymous No.]

>>36446547
Unrecoverable

[Anonymous No.]

>>36446478
Technically true, but it's preferable to having Sotsu as the conclusion.

[Anonymous No.]

>>36446472
Rika was magic to begin with and could see Hanyuu straight away.
But this is irrelevant now as Satoko can see her too even though she had no special powers to begin with. Eua can override everything. Ryukishi a hack.

[Anonymous No.]

I think it's difficult to save Sotsugou. In 4 episodes there's nothing much to recover. In a new season you would have to wonder why they need 3 fucking seasons. It's not gonna get more than 15 episodes apparently because it's not scheduled that way. I don't expect to be impressed.

[Anonymous No.]

>>36446613
I just think it's dumb to have to wait til 2022 for a resolution. But then again there are people who are waiting until then, or later on, for phase 2.

[Anonymous No.]

>>36446615
What's wrong with turning someone else into a looper just like Rika? It's like complaining that there's more than one witch in Umineko.

[Anonymous No.]

>>36446615
Everyone could see Hanyuu when they were ghosts at the end of Minagoroshi.

[Anonymous No.]

Higurashi x Muv Luv crossover

[Anonymous No.]

>>36446637
People wait way longer for new seasons, and we even had Sotsu inbetween. Just wait until you've been in the anime community for a few years, a wait like this is nothing.

[Anonymous No.]

>>36446638
I’m saying it’s poorly handled. Rika was meant to be unique from birth with special powers. Hanyuu didn’t give her them.

[Anonymous No.]

>>36446638
I’m talking about the ability to see Hanyuu not the looping.

[Anonymous No.]

I lost my battler with shotgun pic

[Anonymous No.]

>>36446222

[Anonymous No.]

>>36446891
Nice.

[Anonymous No.]

>>36446886
This one?

[Anonymous No.]

>>36446906
battler's trousers are so awful

[Anonymous No.]

>>36444488
For whatever reason are we getting this flashback in the next episode? Now things are getting interesting.

[Anonymous No.]

>>36447024
It's unexpected at least. I still want to know what the fuck this means though.

[Anonymous No.]

>>36444907
Yeah, just like all japanese girls go 'meep meep'
Nevermind the fact that both are bad localizations.

[Anonymous No.]

Yui Horie saying wow wow wow

[Anonymous No.]

>>36446414
This isn't Nekoakashi.

[Anonymous No.]

>>36446123
Ange, JK Satoko, and a literal COW beside each other, then any character you want from WTC say while looking at them "I see no difference"

[Anonymous No.]

>>36447041
It's just ひ for ひぐらし。

[Anonymous No.]

>>36447055
She almost does, it's not like hauau is far from wauwau.

[Anonymous No.]

>>36446441
Based

[Anonymous No.]

>>36446223

[Anonymous No.]

Tegakianon never once drew a Higanbana character

[Anonymous No.]

Sotsu episode 12 synopsis: We're going to see a bit of Hanyuu's POV as she something something to give Rika that memory boon. Eua is not entertained. Satoko gets the sword. Rika does not dance. Rush to Akasaka's murder-rape-arson. Roll credits.

Next episode is 10+ minutes of unfilterd satorika sex followed by lots of hugging and crying and a skip to the birthday scene cliffhanger.

The remaining 2 episodes are just sex. Nothing but sex. Not a single word of dialog that isn't just horny moans and screaming each others' names. We never get an answer to what happened, but this is the ultimate ending to Higurashi, the culimnation of everything. Thank you for watching..

[Anonymous No.]

>>36447337
The following, but the sex is between Satoko and Tomita

[Anonymous No.]

>>36447337
That's too ideal, I don't think it will be that but if it was, Sotsu would go from a 4/10 to a 9/10

[Anonymous No.]

>>36447097

[Anonymous No.]

>>36447347
No, between everyone.
I distinctly remember a post where anon listed all the sex but I can't find it in warosu now.
Which is sad, because it was a good post.

[Anonymous No.]

>>36447443
Based Cowchad Thanks

[Anonymous No.]

>>36447443
Cute baby cow.

[Anonymous No.]

Enje died a virgin

[Anonymous No.]

>>36447274
Is Higanbana a Higurashi OAV that I missed like Daybreak?

[Anonymous No.]

>>36444488
Wait, this isn't right!
Hanyuu was supposed to be SatoRika's child, not their babysitter.

[Anonymous No.]

Hanyuu has very little use.
Utility is low.
Overall performance is poor.
There’s not much point in Hanyuu.

[Anonymous No.]

oregnant hanyuu

[Anonymous No.]

Reminder that we will never get winter Hinamizawa because of muh cicada season.

[Anonymous No.]

Hanyuu is onahole

[Anonymous No.]

what is hanyuu's special technique for the customers at angel mort?

[Anonymous No.]

>>36444478
Ohhh, witch Satoko is already starting to break down? That was fast, it's only been 2 episodes.

[Anonymous No.]

Hypnotized Enje
but for what purpose?

[Anonymous No.]

>>36447778
just imagine a witch who's infinitely close to the seat of god serving dirty otaku customers in a whore suit at angel mort

[Anonymous No.]

>>36447817
They can’t see her though. As usual she is of no use.

[Anonymous No.]

Hypnotizing Enje into doing exercise

[Anonymous No.]

>>36447813
Her complaints where too loud when hooked up to the milking machine, this is much nicer.

[Anonymous No.]

>>36447823
why can't they see her clothes

[Anonymous No.]

Today's pointless Mei trivia of the day.
Angel Satoko is the first one to have two different character activated skills, both obviously for Rika.

[Anonymous No.]

>>36447915
That's cool but being a gacha in japanese only ain't attractive to me

[Anonymous No.]

>>36447823
Hanyuu can become corporeal when she wants.

[Anonymous No.]

Enje working at Enjel Mort

[Anonymous No.]

>>36447941
Satoko isn't attractive to you? Based.

[Anonymous No.]

For me it's Rena > Shion > Mion > Satoko > Rika
Describe my physical appearance

[Anonymous No.]

>>36447792
That's obviously a delighted expression.

[Anonymous No.]

>>36447972
This failure can’t do that.
Especially not in Sotsu.

[Anonymous No.]

>>36448206
I've heard that autism can cause difficulties interpreting facial expressions, particularly microexpressions, but I didn't know it could extend to anime faces.

[Anonymous No.]

>>36448223
no i think he's right, eviltoko is looking at the disaster that akasaka caused and is laughing

[Anonymous No.]

>36448223
I don't care if you have autism or not, but in case you're incapable of reading that expression: it's a delighted one.

[Anonymous No.]

>>36448223
For me, this face screams to me that she just run out of toilet paper and is going to kill herself and fix that in the next loop.

[Anonymous No.]

I'm autistic and my favorite WTC is Lambdadelta

[Anonymous No.]

>>36448263
Hi, autistic and my favorite WTC is Lambdadelta, I'm Anonymous

[Anonymous No.]

>>36448223
It’s clear that this face is the one you make when you see that Kinzo is afraid to commit the same sin again.

[Anonymous No.]

kinzpのsin

[Anonymous No.]

>>36448251
>>36448288
For me, this is the face of a person who is breaking down under the guilt of her actions. But I'm autistic too so maybe I'm wrong.

[Anonymous No.]

>>36443598
What is this face expressing?
Why is Rika squeezing an empty can?

[Anonymous No.]

>>36448206
>>36447792
Honestly for me (without context) it could be interpreted as both, stop being autistic.

[Anonymous No.]

>>36448337
you know

[Anonymous No.]

Even Kinzo became autistic when Beatrice died (or two Beatrices or however many)

[Anonymous No.]

>>36448337
Isn't she about to break down?
Honestly I don't know, I'm autistic sadly.

[Anonymous No.]

>>36448350
It's interesting that literally every jap comment on the precuts sees mixed emotions, but shitposters in here try to deny it for some reason.

[Anonymous No.]

>>36448443
I mean, yeah, we know she loses the battle of endurance eventually, but she hadn't reached that point yet at that time.

[Anonymous No.]

>>36448454
There's a lot of obnoxious faggots here, and I don't like that

[Anonymous No.]

>>36448454
Sotsu is extremely deep so I think Satoko is thinking about how useless Hanyuu is while watching Akasaka explosion and also considering how autistic the viewers are.

[Anonymous No.]

>>36448454
Considering the likely context, mixed emotions make no sense at all.

We just came from her burying her emotions and she'd back to killing her friends, something she did with a smile before.

That just comes off as wishful thinking of people who want to Satoko to start regretting stuff as soon as possible while disregarding how she has been written in this series.

[Anonymous No.]

I wonder if the femanon loves trolling

[Anonymous No.]

>>36448519
I’m 43

[Anonymous No.]

>>36446547
Release a Director's Cut edition with all the Endless Height crap cut out
Gou/Sotsu is surprisingly good when you keep only the new parts and cut off Rika's dance, which you're seeing it for the 717371th time

[Anonymous No.]

>>36448518
Smart poster

>>36448454
Filthy weeb

[Anonymous No.]

>>36448546
you said 33 last time

[Anonymous No.]

>>36448272

[Anonymous No.]

>>36448518
I was also surpirsed at how quickly the first one happened.

It's even funnier when we had this one moron who was crying that the episode 10 Satoko split came out of nowhere, when literally the entire season was building towards it.

[Anonymous No.]

>>36448561
Rika dance is the second best thing after Rika drinking tea

[Anonymous No.]

>>36448586
Lies.

[Anonymous No.]

>>36448483
I want to be deep in Satoko.

[Anonymous No.]

>>36448638
>>36369633

[Anonymous No.]

>>36444486
yes cum here

[Anonymous No.]

>>36448561
Rika's dance honestly never bothered me before the last episode.
The part from 5:50 (end of Rika's inner thoughts) to 6:40 (cut to Hanyuu in sea of fragments) should be completely cut off. It serves no purpose.

Those 50 seconds could have been used on Satoko's shower scene.

[Anonymous No.]

>>36445746
Fucking Houjou cunts.

[Anonymous No.]

>>36446123
Bern and Lambda trying to learn backgammon

[Anonymous No.]

>>36448679
That’s clearly a different autistic anon who can’t identify facial expressions.

[Anonymous No.]

>>36448746
>>36448621
>Rika's dance ho
nestly never bothered me before the last episode.
I mentioned Rika's dance because it was the first one that came to mind, probably due to last episode.
But that's just one of the many scenes that could've been cut off and it would make the anime better, even if you didn't replace it with anything and made the episode shorter.

I've read that the plan was to remake bait until the end of Watanagashi/Watadamashi. I can't imagine how someone could think this was a good idea.

[Anonymous No.]

>>36446430
>Do we need to know the specifics of how Satoko injected Kimiyoshi?
Would love to know how Satoko injected Mion, for one.

[Anonymous No.]

>>36448595
The entirety of tatariakashi had her feel mixed emotions. They were followed by her witch eyes and evil smile sometimes, that's why people just ignored it as "oh she's just faking it all".

[Anonymous No.]

>>36446518
Anon we tried to figure out your riddle last time, but we don't have any clues
I barely even noticed the link in the first pic, this time it's easier.

[Anonymous No.]

>>36448797
I thought she injected the can and that’s why we see the short scene of the can dropped on the ground.
However the can should sort of leak or explode so maybe it’s just shitty writing.

[Anonymous No.]

>>36447055
whorie

[Anonymous No.]

>>36448845
So can people see her horns or what?

[Anonymous No.]

Time to enjoy Akasaka one last time.

[Anonymous No.]

>>36448892
Oh I'm sure Rika's gonna enjoy Akasaka alright

[Anonymous No.]

>>36448892
Rika is enjoying him for sure in the manga.

[Anonymous No.]

>>36447915
How can people have fun with Mei? No mechanics whatsoever

[Anonymous No.]

>>36448927
I like how Tomato did the brave thing and just had Akasaka rape Rika.

[Anonymous No.]

>>36448938
Well Satoko had Teppei, so Rika at least deserved to do it with a man she loves.

[Anonymous No.]

>>36448938
One has to wonder if she's willing to take his dick again after all of this is solved. Didn't she want it so bad?

[Anonymous No.]

>>36448746
>Those 50 seconds could have been used on Satoko's shower scene.
BD version:
Rika arrives at the Houjou residence a minute earlier, goes inside and hears Satoko happily humming in the shower. Rika decides to get naked and sneak into the shower with Satoko. Rika completely misses the bloody clothes because meep. Satoko quickly hugs and kisses Rika before she can see the blood on her. They make out in the hot shower until Rika is dizzy, then Satoko escorts euphoric Rika out, careful to not let her see any of the mess. The rest of the episode goes on like the TV version, except Satoko didn't get off and is even more horny around Keiichi. Basically drooling, grabbing more than his hand, dryhumping him instead of gently hugging, guiding his hand to her chest instead of just holding it in her hands, starting to undress at her house before getting the bat.

[Anonymous No.]

>>36449023
It's okay, manga Rika doesn't remember.

[Anonymous No.]

How does this make you feel?

[Anonymous No.]

>>36444493

[Anonymous No.]

>>36449125
What a messy eater. Not even Hanyuu was this dumb with creampuffs.

[Anonymous No.]

>>36449115
Yamitoko

[Anonymous No.]

I woke up from an unpleasant dream earlier, and when I closed my eyes to try and sleep, I saw a witch and she dropped references to the bad dream, so I couldn't go back to sleep
I was thinking why not just grab the witch and start raping her sort of like this, but what if the witch was my mom or something, so I didn't do that
why did kinzo have to have a incest rape baby, he ruined everything

[Anonymous No.]

>>36449148
Why not make as many as you can to see what happens when they all become witches?

[Anonymous No.]

>>36449148
Delete the picture. Only Sakutato is allowed to sex Luci-nee.

[Anonymous No.]

>>36449115
Like Higurashi characters would be memorable one-arc Yu-Gi-Oh villains. Like Yugi and co have to duel everyone in Hinamizawa, in a tournament the three families organise with hilariously over the top horror vibes and ridiculous faces.

[Anonymous No.]

>>36449181
Who's Sakutato

[Anonymous No.]

Left: Succubus
Right: Onahole

[Anonymous No.]

Ciconia is a sub-reality to the greater world revealed in Umineko, which means that everyone pushing simulation theory onto the other WTC works fails to understand that even if simulation theory is the answer to Ciconia, it only applies to the world of Ciconia, it is completely contained within the sub-reality (fragment, game board, etc.) that Ciconia takes place in.

[Anonymous No.]

>>36449212
Sakutaro's cool older brother

[Anonymous No.]

I did have a dream just a few days ago about Ryuukishi tweeting that witch satoko was like yami yugi

[Anonymous No.]

>>36449217
Their heads look weird but I can still fap to this.

[Anonymous No.]

>>36449212
It's a potato who looks like Satoshi.

[Anonymous No.]

>>36449217
What a cute pair of cumsluts

[Anonymous No.]

>>36449230
As always with this artist. I think that's the first time he's drawn Rika?

[Anonymous No.]

>>36449245
>first time he's drawn Rika?
No, wait, there's this one.

[Anonymous No.]

>>36449125

[Anonymous No.]

>>36448595
>when literally the entire season was building towards it.
>2 scenes

[Anonymous No.]

>>36449304
at least try to fix the color balance, anon

[Anonymous No.]

>>36449304
NOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO

[Anonymous No.]

>>36449209
Her deck would definitely be around trap cards.

[Anonymous No.]

Okay I'm going to have to rearrange the order in which I explain this theory because it doesn't read very well as is.

[Anonymous No.]

>>36449320
Odiontoko

[Anonymous No.]

>>36449309
Dumb goat poster

[Anonymous No.]

>>36449364
Not as dumb as anon saying THE ENTIRE SHOW FORESHADOWED THIS HUUUUR

[Anonymous No.]

>>36449321
Are you... are you trying to make a schizo theory more presentable? Cull the insanity out of it?

[Anonymous No.]

>>36449311
I honestly tried but I don't have the photoshop skills
but if you know what buttons I need to press, I can try fixing it!

[Anonymous No.]

>>36449326
I need to ask Tegaki anon to draw next Odiontoko

[Anonymous No.]

>>36449402
Paste it on a new layer then do some combination of editing the levels (ctrl+L in PS, the auto setting usually looks pretty good), or adding a color overlay (double click on the layer and select it from later styles, set it to low opacity and make the color gray or skin tone).

[Anonymous No.]

>>36449423

[Anonymous No.]

Could you imagine if it was one of those "it was all a dream or simulation" endings?

[Anonymous No.]

>>36449380
Umineko foreshadowed this

[Anonymous No.]

>>36449432
ok how does this look

[Anonymous No.]

>>36449115
Rena plays Ayyliens with Gol'gar
Satoko normals Vega set 4 passes every opening

[Anonymous No.]

>>36449476
/dbs/ needs to get pancreatic cancer.

[Anonymous No.]

>>36449476
maginally better

[Anonymous No.]

>>36449476
It looks like dogshit, please don't bother

[Anonymous No.]

>>36449309
>>36449380
He's right, you know.
Entirety of Satoko's character development in Sotsu was building to it, she had doubts to begin with and went too far to be able to reconcile her actions. And Satoko takes most of the screentime, so it's not even the slightest exaggeration to say the entire season. Hell, it started before Sotsu when Gou episode 23 made it clear that Witch Satoko can't suppress her deepest human feelings that easily.

I'm sorry that you can't read the characters at all and have to complain about obvious developments when they happen. Though that's to be expected from one whose rhetoric ability is limited to inane greentext/capslock implications.

[Anonymous No.]

>>36449531
Like I said, 2 scenes aren't "the entirety" of anything, I don't think I stuttered.
Sorry that my delectable posting methods offend your sensitive festering wound.

[Anonymous No.]

>>36449531
S-sperg BTFO
How will he recover from this logic.

[Anonymous No.]

>>36449566
Now you're being a pedant. His point was that it was amply foreshadowed, with several scenes and even a whole episode about it, not that the entire show was dedicated to it.

[Anonymous No.]

>>36449630
>so it's not even the slightest exaggeration to say the entire season
>when literally the entire season was building towards it.
>His point was that it was amply foreshadowed
>LITERALLY the entire season
I see.
Well, it IS ESL hours....

[Anonymous No.]

>>36449645
A scene about Satoko's inner conflict appeared in episode 1 of Sotsu, so he's right. Again, you're being a pedant and ignoring the heart of the argument. If you're thying to cosplay Bern you're doing a great job.

[Anonymous No.]

>>36449566
I don't even know what you mean with 2 scenes, tranny-obsessed shitposter-kun. Almost every scene of Satoko is part of the buildup. Literally the entire season.

[Anonymous No.]

>>36449664
>A scene about Satoko's inner conflict appeared in episode 1 of Sotsu
This. How can people forget satoko looking mildly bored at Rena for 5 seconds in the beginning of Onidamashi before plunging her into despair? That was ample foreshadowing of her inner conflict, just like satoko not flexing her witch eyes every time she tells a lie. That was ample foreshadowing as well.

[Anonymous No.]

>>36449664
>so he's right
>LITERALLY the entire season
No, "he" LITERALLY isn't.
Just accept the fact that you were wrong.

>>36449695
>I don't even know what you mean by "2 scenes"
That's a "you" problem. I meant that the "build up" was there for two scenes.
>ALMOST EVERY scene
>literally the entire season
Learn English, please.
And it was just 2 scenes of Satoko having slight doubts, dare I say "lol"? Because 2 scenes aren't LITERALLY the entire season.
I won't respond to your requests for attention any further. It's obvious that you are never letting this conversation stop without you having the last word, even if you can't make an argument besides "I-I don't get it". Amazing.
No wonder the threads got ruined like this when we have shitposters that spam entire threads with idiotic arguments, hyperbolic statements and imageflooding because we didn't like the op of the other thread, or something.
>>36449787
See, you just can't stop. Two short scenes don't make an entire season. I am going to wear this on a placat and go outside the Japanese embassy in Washington.

[Anonymous No.]

>>36449819
Oh it's you again.

[Anonymous No.]

>>36449834
Hello, hope you are in good health.

[Anonymous No.]

>>36449819
Why does japan have an embassy in washington?

[Anonymous No.]

Wow, someone's literally going insane.

[Anonymous No.]

>>36449819
This butthurt burns my eyes.

[Anonymous No.]

[Anonymous No.]

Will we see literal hell in Ciconia?
I wonder how that is like...

[Anonymous No.]

>>36449914
All I see is stubs. The gates of my garden are closed to trash like that.

[Anonymous No.]

>>36450095
>All I see is stubs.
I did tell you to never look between your legs again.

[Anonymous No.]

>>36450095
Stubs? Why dirty up the place when you can just disable them and deny their existence?

[Anonymous No.]

>>36450281
For the occasional false positives

[Anonymous No.]

I am just enjoying the fact that you have to manually hide posts.

[Anonymous No.]

>>36450364
Post manually hidden!

[Anonymous No.]

Bros, why is my Enje so bright? Enje is supposed to be a cool edgy character, not this bright faggotry.

[Anonymous No.]

POST HIDDEN

[Anonymous No.]

Cownge

[Anonymous No.]

>>36450198

[Anonymous No.]

>>36450423
Fat resolution as expected of Ange

[Anonymous No.]

Satoko's inner conflict was foreshadowed all the way in Satokowashi-hen in Gou.
Anyone who says otherwise literally can't read characters.

[Anonymous No.]

>>36450402
the ps3 version was really nice to her face and waist.

[Anonymous No.]

>>36450459
Everyone remembers the scene with Teppei. People's problem is that there were only two moments of regret in Sotsu regarding the rest of the cast.

[Anonymous No.]

>>36450434
Why did they have to make her so hot? She doens't even do anything. She just sits there and laughs, sometimes she dumps exposition, that's it.
Still the hottest character of the show. Why is so erotic? Why does she make my penis bigger?

[Anonymous No.]

>>36450503
Satoko is hotter than Eua.

[Anonymous No.]

>>36450516
I will murder you.

[Anonymous No.]

07th Expansion works are only appreciated by hag lovers and loli lovers and there is no in between

[Anonymous No.]

>>36450525
Why can't we live in peace? Me up here, and you down there, where you belong.

[Anonymous No.]

>>36450534
Ah, I see you have to make this about your ego. No. Eua is hotter. You are a pedo.

[Anonymous No.]

>>36450503
Featherine/ikuko is also the hottest winner In Umineko and she has no direct interaction with the events on the island.
She just picks up a refugee and writes fanfiction for profit and to ruin Ange’ life.

[Anonymous No.]

>>36450542
It was a joke. I like Eua too. She's very cute.

[Anonymous No.]

>>36450544
Thank you for this detailed information about Featherine's character, dear anon.
>>36450556
Ah, shit! H-haha.

[Anonymous No.]

>>36448595
That's me and I was saying it because it makes zero fucking sense for Satoko to forgive Rika because of what Teppei did. Also again, that screenshot is nothing, we know for a fact Satoko felt nothing for Rena.

[Anonymous No.]

>>36450561
It’s important to acknowledge winners

[Anonymous No.]

>>36450590
Obsessed

[Anonymous No.]

>>36450595
It's too bad that Gou had to be made in order for her to get more than like, 10 fanarts

[Anonymous No.]

>>36450616
That nose is bad.

[Anonymous No.]

>>36450616
Her console art gave her an ugly face, which probably played a bit role in her lack of art before Gou.

[Anonymous No.]

>>36450627
>>36450647

[Anonymous No.]

>>36450700
>>36450434

[Anonymous No.]

>>36450616
Eua =/= Featherine

[Anonymous No.]

[Anonymous No.]

>>36450749
Proof?

[Anonymous No.]

>>36450757

[Anonymous No.]

>>36450776
The major differences are that Eua is wearing a miko outfit and has Satoko Syndrome (34 Syndrome?). Besides that it's really about the same.

[Anonymous No.]

[Anonymous No.]

>>36450776
Hanyuu = Featherine and Hanyuu =/= Eua

[Anonymous No.]

>>36450839
>Hanyuu =/= Eua
Proof?

[Anonymous No.]

I got Enje in the correct color. But at what cost?

[Anonymous No.]

>>36450852
Why are you ruining reality, anon?

[Anonymous No.]

>>36450848
She calls her a failure. Would she call herself a failure? Obviously not.

[Anonymous No.]

>>36450864
>Would she call herself a failure?
If she ever self-reflected, yes.

[Anonymous No.]

WHAT THE FUCK
I SWITCHED ENJE SPRITES AND NOW SHE'S TOO DARK
WHY??????

[Anonymous No.]

>>36450892
Dange

[Anonymous No.]

>>36449217
fEAUtherine AUgustus Aurora

[Anonymous No.]

>>36450864
Besides the fact that the "her" you're speaking of isn't even Hanyuu, yes actually.

[Anonymous No.]

Euarrumatio

[Anonymous No.]

Eua's seiyou whispering sweet nothings in my ear

[Anonymous No.]

Eua's diet

[Anonymous No.]

>>36450864
A character who undergoes self improvement tends to look down on their past selves, that's a pretty common trait. Like how Tsumihoroboshi Keiichi thinks poorly of his Onikakushi self.

[Anonymous No.]

>>36450527
A good number of the lolis are also hags.

[Anonymous No.]

>>36446472
>>36446480
>>36446488
Oh I get it, since Hanyuu dies in this episode, they're gonna try make it extra emotional by showing her old scenes.

[Anonymous No.]

>>36450903
>>36450864
Note that the term used for lingering scent Hanyuu (残り香) is the same one WitchSatoko used to reference human Satoko.

[Anonymous No.]

>>36450947
Cum only.

[Anonymous No.]

>>36444488
did she watch people having sex?

[Anonymous No.]

>>36451017
Along with anon's semen, she drinks tea and Mountain Dew, and eats popcorn, Cheetos, etc.

[Anonymous No.]

>>36451039
all made out of my cum

[Anonymous No.]

>>36451039
So relatable.

[Anonymous No.]

>>36447817
I don't have to imagine when hanyuu makes me cum on a daily basis.

[Anonymous No.]

>>36449922
no one is gonna convince me R07 isn't closeted trans
also
>triple dubs
checked

[Anonymous No.]

>>36451366
WTC is his closet.

[Anonymous No.]

phase 2?

[Anonymous No.]

>>36451405
phased out of existence.

[Anonymous No.]

[Anonymous No.]

>>36451448
rikute

[Anonymous No.]

>>36450757

[Anonymous No.]

>>36450516
Thanks, Captain Obvious.

[Anonymous No.]

>>36451448
This concept is the second best thing about Gou.

[Anonymous No.]

>>36451834
Satoko on top feels so right

[Anonymous No.]

Nii-Nii! Let's play baseball!

[Anonymous No.]

[Anonymous No.]

>>36451869
How come Rika gets to have TWO Satokowives and I have zero?

[Anonymous No.]

>>36451842
you just want to be on top of and pin rika

[Anonymous No.]

>>36451899
I want Rika from every way and every position imaginable.

[Anonymous No.]

>>36451834
What's the first?

[Anonymous No.]

[Anonymous No.]

A silly Satoko Teppei story
1/6

[Anonymous No.]

Don't open this spoiler if you like Ushiromiya Enje

[Anonymous No.]

>>36452071

[Anonymous No.]

>>36452084
I don't like her so I will open it.

[Anonymous No.]

>>36452084
Everything is too bright.
FIX IT

[Anonymous No.]

>>36452084
Holy based

[Anonymous No.]

>>36452084

[Anonymous No.]

>>36452088

[Anonymous No.]

>>36452084
Jesus Christ
Why would you create something like this?

[Anonymous No.]

>>36452084
okay but where's the other half of the animation???

[Anonymous No.]

>>36452110

[Anonymous No.]

i want to bite and tear anges left nipple off

[Anonymous No.]

>>36452137

[Anonymous No.]

>>36452161

[Anonymous No.]

>>36452099
I tried my best. Please no bully.
>>36452130
I ended it abruptly because I have no clue how to make the individual pieces of Enje disappear after entering Lambda's mouth.

[Anonymous No.]

>>36452180
7/6
Whoops, it ws actually 9 pages. Hope I got them in correct order.

[Anonymous No.]

>>36452190
I got no idea about video editing but you want a layer or whatever they call it that hides what you put over it, a boolean thingy in a rectangle starting to the right of lambda's mouth. or you can probably make the pieces go away after a certain duration.

[Anonymous No.]

>>36452205

[Anonymous No.]

>>36452220
And of course the whole thing got reposted to pixiv, what a pointless dump this was.
orz
https://www.pixiv.net/en/artworks/92562844

[Anonymous No.]

>>36451890
You need to spend a century grooming your first Satoko until she develops the ideal balance between love and hatred.

[Anonymous No.]

[Anonymous No.]

[Anonymous No.]

>>36452161
>>36452180
what is this thrice damned mesugaki doing

[Anonymous No.]

>>36452440

[Anonymous No.]

Being enslaved by cunny...

[Anonymous No.]

>>36452550

[Anonymous No.]

>>36452440
To quote Satoko on the second page -- My, don't you know what it means when a niece of /that age/ does this to her non-blood related uncle?
She was just going to bed without pajamas and inviting Teppei over. She won't catch a cold if her uncle warms her up!

She planned to seduce Teppei to create evidence of sexual abuse, but it didn't work. So she keeps attacking Teppei every night (apparently with niece x uncle porn) but Teppei just thinks her behavior is all his fault and wants to protect Satoko no matter what.
That is his sin atonement (tsumihoroboshi)

[Anonymous No.]

>>36452084
Why does her delusion now imply vore?

[Anonymous No.]

>>36452693
Lambda isn't part of her delusions

[Anonymous No.]

>>36452735
There is no real magic

[Anonymous No.]

>>36452764
For you

[Anonymous No.]

>>36452764
ngmi

[Anonymous No.]

>>36452770
>>36452777
Read the manga

[Anonymous No.]

>>36452793
changes nothing

[Anonymous No.]

>>36452735
Lambda is just a concept just like Bern

[Anonymous No.]

>>36452793
the mangas getting weird

[Anonymous No.]

https://www.pixiv.net/en/artworks/92566005
onuma kuma got completely carried away with satozuri and made too much of it...

He's already posted like 30 pages on pixiv (way more behind fanbox paywall) and now he's going to make a CG set for DLsite release.

[Anonymous No.]

>>36452853
>this is canon according to mangatards
I know they're mentally ill but this is just delusional.

[Anonymous No.]

>>36452853
Is Lion a male in this one?

[Anonymous No.]

>>36452084
based enje a shit

[Anonymous No.]

>>36452948
does it matter

[Anonymous No.]

Degeneracy, filtered!

[Anonymous No.]

>>36453027
Enje's cute fingers.....

[Anonymous No.]

>>36453027
I filter all Ange images.

[Anonymous No.]

>>36453027
thats pretty funny coming from ange

[Anonymous No.]

Enje is literally me but with a vagina instead of a penis

[Anonymous No.]

>>36453057
Ange hates homosexuals

[Anonymous No.]

Enje impregnated by Mammon
Enje is now a mother

[Anonymous No.]

Where are they going, /jp/?

[Anonymous No.]

Vier regularly fucks younger boys.
Chloe empties Okonogi's balls every day.
Gunhild masturbates in public.

[Anonymous No.]

>>36453186
Please post pictorial proof of these statements.

[Anonymous No.]

>>36453175
Uminegou

[Anonymous No.]

>>36453119
I want to be Enje and Mammon's infant child

[Anonymous No.]

Asmodeus pumping and dumping Jessica

[Anonymous No.]

All the Stakes should just get pregnant with each other

[Anonymous No.]

>>36453195
so to a better place

[Anonymous No.]

>>36453186
Even worse, Leah's eyes are drawn to every dick in her proximity. She simply can't restrain herself.

[Anonymous No.]

Hanyuu's only use.
https://twitter.com/oreizm/status/1434888035385036806

[Anonymous No.]

>>36453293
weird dick

[Anonymous No.]

terrible horny thread, I wish italianon would come back

[Anonymous No.]

I'm only horny for the real Beatrice, not some witch fantasy. So pouty, so cute

[Anonymous No.]

>>36453318
The Enje vore animation is worth more than everything he created in his entire lifetime

[Anonymous No.]

>>36453334
Gross.

[Anonymous No.]

>>36449058
The fact that this won't happen proves that there is no justice in the world.

[Anonymous No.]

>I want to have sex. sex sex sex.
>>36453217
>>36453252
>futa asmodesu uwu
>preggers jessica www
>preggers stakes owo
>>36453293
hanyuu facial, I'm so *horny* I have to post literal porn
GO TO /h/ FUCKING NIGGERs
>36453336
>t-the enje vore animation is *cums into own hand and drinks it* b-better than everything h-he ... *cums again* ever created i-in his entire lifetime *smugface*

Have sex you literal incels, this isn't a blue board for no reason.
Nobody gives a shit about your weird fetishes and repressed homosexuality.

[Anonymous No.]

>>36453432

[Anonymous No.]

Hello is this the Lambdadelta appreciation general?

[Anonymous No.]

>>36453547
In a way, yes.

[Anonymous No.]

>>36453547
no, we dont like lady reddit

[Anonymous No.]

>>36453547
We all like Lambdadelta here.

[Anonymous No.]

>>36452161
>>36452180
This shit is just outright wrong

[Anonymous No.]

>>36453547
no, this is fate general

[Anonymous No.]

>>36453598
I always wondered, why did the autistics of the 90s and 00s absolutely dominate what we know now? 07th, Type Moon, ZUN, etc etc
Were they just in the right place at the right time? Did they all talk to each other?

[Anonymous No.]

There are no attractive female characters in Fate/Stay Night. How did Nasu screw up so badly after Tsukihime?

[Anonymous No.]

>>36453632
They were just good at what they did and gave the people what they longed for, simple as.

[Anonymous No.]

>>36453649
wtf is this writing

[Anonymous No.]

>>36453664
nasu the master

[Anonymous No.]

>>36453356
You take that back. Kuwadorian Beatrice is real, cute, and half-Italian

[Anonymous No.]

>>36453635
Rider's pretty hot

[Anonymous No.]

>>36453575
Why only those two pages, anon? All the other pages are pretty much the same gag. Satoko trying to get Teppei to take baths with her, etc.

[Anonymous No.]

>>36453432
ooo the bernfag is extra angry today

[Anonymous No.]

>>36453705
I just judge with my eyes

[Anonymous No.]

>>36453716
Do you think people read with their noses or something

[Anonymous No.]

>>36453732
duh

[Anonymous No.]

>>36453709
It's *****

[Anonymous No.]

>>36453705
satok is undressed there obviously

[Anonymous No.]

>SATOKO LAMDA SATOKO RAIKA SATOKO
Yeah this thread reeks of cringe.
Time to fix that with some BADASS ACHA kino.
https://www.youtube.com/watch?v=hXB53OyTsPM

[Anonymous No.]

>>36453736
seiba?

[Anonymous No.]

>>36453780
Couldn't think of anyone relevant to the thread?

[Anonymous No.]

Nasu has better male characters
Ryu07 has better female characters

[Anonymous No.]

>>36453805
Wrong and wrong, did you mix up their names or something?

[Anonymous No.]

>>36453805
I agree.

[Anonymous No.]

>>36453709
Couldn't think of a way to refute his points, huh?

[Anonymous No.]

>>36453800
Ooishi, Irie and Battler are the only characters I genuinely like.
Battler is the least one though because he's basically a different person after ep 5

[Anonymous No.]

>>36453831
Nasu has Tohno Shiki
Ryu07 has Lambdadelta

That alone is enough to make a verdict

[Anonymous No.]

>>36453853
everything not fate doesn't count

[Anonymous No.]

>>36453805
Nope, Nasu is better in both.

[Anonymous No.]

>>36453862
Well I guess I shouldn't count Umineko either if we're ignoring their best works

[Anonymous No.]

Ryukishi has superior characters and art
Nasu has superior writing and plot

[Anonymous No.]

>>36453865
Even Sacchin is going to have a route soon, and Illya still doesn't. Isn't it sad, Illya?

[Anonymous No.]

>ryukishi girls are better
>nooo nasu girls are better
ENTER

[Anonymous No.]

>>36453886
>Ryukishi has superior art
lmao

[Anonymous No.]

>>36453897
Even at Takeuchi's best, he's no match for this.

[Anonymous No.]

>>36453893
Illya doesn't need a route, everyone already loves her!

[Anonymous No.]

>>36453917
woah... the SOVL is too much...

[Anonymous No.]

>>36453897
Far superior, indeed. His art elevates his writing to a new level.

[Anonymous No.]

>>36453962
People are obsessed with Satoko when she looks like THAT

[Anonymous No.]

That's it. Absolute lowest this general can get Worst thread ever. I'm shifting realities and moving to Rokenjima in 86.

[Anonymous No.]

>>36447813
so she can start a diet

[Anonymous No.]

>>36453895
I don't know who this is..

[Anonymous No.]

>>36453990
That's right!

[Anonymous No.]

>>36453962
It's actually difficult to assess what might be a finger on those boxing glove hamfists,

[Anonymous No.]

>>36452084
holy kek
fuck you ange

[Anonymous No.]

>>36454047
I see two reasons to obsess over Satoko.

[Anonymous No.]

>>36454068
post hidden!

[Anonymous No.]

More SOVL than the Higus, stronger than the witches and cuter than Satoko fifty times over.
Ryukishi will never ever be able to create such a perfect character.

[Anonymous No.]

>>36454077
You want to see more?

[Anonymous No.]

>>36454077
1. Her cute smile!
2. Satoko!!!

[Anonymous No.]

>>36454047
I despise Satoko!

[Anonymous No.]

>>36454088
Yuuka can't even defeat a dumb doll.

[Anonymous No.]

>>36454112
Same.

[Anonymous No.]

>>36454101
Yes.

[Anonymous No.]

>>36454157
...

[Anonymous No.]

i came really hard and it still feels good down there 15 minutes later

[Anonymous No.]

>>36454173

[Anonymous No.]

>>36454186
Quality post.

[Anonymous No.]

>>36454186
At least someone's having fun and pleasure

[Anonymous No.]

>>36454186
I'd like an Ushiromiya aunt to take personal ownership of my dick so I don't masturbate too much.

[Anonymous No.]

>>36454088
>>36453962
The only reason you folks don't dismiss this stuff as deviantart-tier is because it's attached to things you love and because of its amateurish nature that instantly makes your brain perceive them as quaint and "soulful", same reason humans are conditioned to root for the underdog in a movie.

[Anonymous No.]

>>36454244
but it's yasu

[Anonymous No.]

うーん，javascript がコケているわけではないのか？ ... ウミネコ(Umineko) UM-SH-01 耐寒-25度 本格 マミー型 ダウン シュラフ 寝袋 クラウドライト ス

[Anonymous No.]

>>36454257
Ryukishi is actually a very good chibi artist with quite unique and pleasant style. Especially his Higurashi sprites and older drawings were great.
Can't think of anything positive to say about ZUN.

[Anonymous No.]

[Anonymous No.]

>>36454088
Hey it's Hikage! But why is she smiling?

[Anonymous No.]

>>36454186
Why do the steam sprites ooze so much soul?
I could never get warm with the ps3 art or the OG jank sprites.

[Anonymous No.]

>>36454336
I know, right. They're very spirited and I don't know why people don't like them.

[Anonymous No.]

>>36454368
contrarianism and nostalgia, that's it.

[Anonymous No.]

>>36454368
I really don't like the sprites for some of the adult characters and Rena. Rena looks like a creepy doll on Steam sprites. Mion has a forehead that's bigger than Ooishi. Tomitake looks weird no matter the sprite, but this version, along with Takano's, makes the game really seem like a weird eroge.

[Anonymous No.]

>>36454368
>>36454336
They're not my favourite set but I find sprite purism pretty tedious so good for you if you like them anons.

[Anonymous No.]

i like both but pachinko sprites kinda suck, like what the fuck is up with hanyuu, she's so round, she looks like a fuckin alien

[Anonymous No.]

>>36449621
I'm going to crush your head like a watermelon. You P*ssed me off...

[Anonymous No.]

>>36454404
>Rena looks like a creepy doll on Steam sprites.
Well, she is creepy.

[Anonymous No.]

>>36454316
We could have had this.
But instead Ryuukishi chose to forget that Shion and Satoshi exist.

[Anonymous No.]

>>36453318
Me too...

[Anonymous No.]

>>36454428
S-Sperg bros.
We s-stutter a lot.
Maybe we lost.....
>I-in before Sperg daily shitpost.

[Anonymous No.]

>>36454449
It's because it's so cold here in this loveless place...

[Anonymous No.]

>>36454436
Yeah, but I find -all- of her steam sprites creepy. Whereas I only find this one sort of creepy if not funny.

[Anonymous No.]

>>36453336
>DUDE LMAO VORE XD
Guess how I know you have no chin? Stop jerking off and go touch grass, It's labor day

[Anonymous No.]

At episode 2 of Umineko and it took me almost 10 hours to read ep1.
How long is it?
Am I just a slow reader...?

[Anonymous No.]

>>36453432
Based, Just fucking based. J/a/nnies are literally having a mental breakdown right now from your post!

[Anonymous No.]

Eua is probably a lesbian

[Anonymous No.]

>>36454470
That's not too unusual of a playtime I don't think. They're mostly between 8-12 hours.

[Anonymous No.]

>>36453336
Can you post it?

[Anonymous No.]

>>36454470

[Anonymous No.]

>>36454470
Speed readers get to 80 or 90 hours. You're about to enter one of the most boring ass fucking episodes of Umineko, and they're gonna get longer than that.

[Anonymous No.]

>>36453780
KINO!!!

[Anonymous No.]

>>36454470
That's normal, they are all around 10 hours average. If you listen to every voice line or spend a ton of time trying to solve the locked rooms it's more like 12 hours average.

[Anonymous No.]

>>36454481
Scroll up. It got many replies.

[Anonymous No.]

>>36454487
None of the episodes of Umineko are boring.

[Anonymous No.]

>>36454483

[Anonymous No.]

>>36454470
I wish it were longer.

[Anonymous No.]

>>36454487
At least it won't be as boring as episode 7.

[Anonymous No.]

>>36454436
I mean, this look is perfect for a horror novel like higurashi.
She just looks funny in the OG set.

[Anonymous No.]

>>36454499
The Shannon romance arc is terribly boring but also extremely important to the plot and themes later on.

[Anonymous No.]

>>36454499
EP2 is an absolute slog, specially on a reread. It killed my momentum completely to the point I put it off for 5 months.

[Anonymous No.]

>>36454494
kek, you were right, it's a masterpiece

[Anonymous No.]

>>36454442
What are you doing here little /a/tard? did you get lost when clicking /a/?

[Anonymous No.]

>>36454510
KEK Tis truly was!!!! Are you also trans btw!!?

[Anonymous No.]

>>36454506
>>36454509
It introduces interesting themes like the idea of love as the single element of the world and has some very touching scenes including the first mention of the thematic motto.

[Anonymous No.]

[Anonymous No.]

>>36454529
This but the opposite way

[Anonymous No.]

It's that time again. Enjoy your spergfest.
Euro hours are best hours. Until tomorrow.

[Anonymous No.]

>>36454534
That's just old Higurashi. The tables have turned, now.

[Anonymous No.]

>>36454459
That shit isn't intimidating in the slightest, though.

[Anonymous No.]

>>36454539
Sadly I still won't be here :( since you know, It's labor day. But don't worry I'll still post occasionally ;P

[Anonymous No.]

>>36454529
I hate when satoko does this to me...

[Anonymous No.]

>>36454558
Man, just looking at this gives me the chills.
Steam sprites truly are the best if you're going for the horror atmosphere.

[Anonymous No.]

>>36454522
Yes, ty for noticing uwu

[Anonymous No.]

>>36454579
Beatrice isn't trans she's a biologicaly woman

[Anonymous No.]

>>36454596
Which Beatrice?

[Anonymous No.]

>>36454605
>People in 2021 STILL believe in the non-canon manga
Goats everyone

[Anonymous No.]

>>36454558
Her head is like a giant egg supported on a tiny neck.

[Anonymous No.]

>>36454625
Spergs in any era still not believing in the golden truth.
Spergs everyone.

[Anonymous No.]

>>36454631
Just stfu man, I just watched train to busan and am not in the mood for this shit.

[Anonymous No.]

>>36454571
Yeah. It legit spooked me a little when her eyes first went funny.
I suppose people with the original sprites must have had a pretty different experience.

[Anonymous No.]

>>36454631
>n-no the manga HAS to be canon! Why? because...BECAUSE I SAID SO OKAY!
>Who cares if Ryukishi has lied in interviews before and that I'm a loveless goat who couldn't find the truth of umineko within the VN. I voted joe biden and I love abortions
Uh Goat-kun I think your getting carried away

[Anonymous No.]

>>36454643
Worthless shitposter.

[Anonymous No.]

>>36454643
Isn't that the one with all the scary zombies!...

[Anonymous No.]

>>36454605
Doesn't necessarily have to mean a boy, yada yada, you know how the usual talk goes. Just let people think Yasu's a woman if they want, it's left vague on purpose.

[Anonymous No.]

>>36454651
Holy shit, I just got to reply to this bait!
It's just so anger inducing! I'm so furious!

[Anonymous No.]

>>36454647
I'm mixed on the OG sprites, but the simple childishness of their expressions made Rena's angry face stand out compared to her normal appearance and it freaked me out somewhat.

[Anonymous No.]

>>36454647
>OGfans have funny meme sprites
>ps3fags lack photorealistic backgrounds
I'm really glad that I stumbled upon higurashi by accident last year on steam and not through the 07th mod advertisers. It literally combines the best of both worlds and comes with trophies and trading cards.

[Anonymous No.]

>>36454675
I'm just impressed at Nanjo's skills on a remote island several decades ago.

[Anonymous No.]

>>36454676
>i-if i'm being ironic maybe I can pass my pure rage off as irony...
Come here little /a/-tard, Get ready to fly! Weeeeee! Woosh! Ahhhh get down enemy planes! Mayday Mayday we're going down Blomsh! Hahahaha That was fun! Now get inside and finish your homework you have school tomorrow!

[Anonymous No.]

>>36454651
Have you even read it?
It's very good. Check out this CANON manga image.

[Anonymous No.]

>>36454704
>Blomsh

[Anonymous No.]

>>36454675
Pfthahahaha.

[Anonymous No.]

>>36454704
Never fear, Sperg is here!
I'm sorry your Italian husband left you. He was impressive compared to you.

[Anonymous No.]

>>36454706
I've never read the manga or the animes (besides gou and sotsu). Only the Vn is of value! but wtf is lion doing in the manga! is she tasting soup?

[Anonymous No.]

>>36454712
I really really love that image anon :)

[Anonymous No.]

>>36454704
>blomsh
as expected of a quality poster

[Anonymous No.]

>>36454722
>Never fear, Sperg is here!
That's pretty based and kino desu like I'm a super hero!
>The rest of your post
Be quiet before I pop your eyes out... last warning

[Anonymous No.]

>>36454293
const ange = f => a => x => t => f(a(t)) (x(t));

[Anonymous No.]

So ... we stopped pretending to like Satoko now?
Good.

[Anonymous No.]

>>36454723
>she
Damn sort yourself out.

[Anonymous No.]

>>36454740
>>36454712
Alright what else does it sound like when you crash? Phusw? Prooh?

[Anonymous No.]

>>36454750

[Anonymous No.]

>>36454745
He left you...
Unworthy.

[Anonymous No.]

>>36454755
Lion is a girl, The only reason why yasu couldn't have kids is that her ovaries fell out in the fall.

[Anonymous No.]

>>36454758
I don't know honestly it just made me think of the blompf meme

[Anonymous No.]

>>36454775
He's just taking a break, The recent state of these threads can take a lot out of a man. He'll be back! I just know it!

[Anonymous No.]

do you want to have a bad time kana? kana?

[Anonymous No.]

>>36454750

[Anonymous No.]

>>36454788
I still cringe when I hear people call trump Drumpf irl...

[Anonymous No.]

>>36454797
Imagine being abandoned for arguing about Fallout on /v/ of all things. How sad.

[Anonymous No.]

>>36454813
You'd have to be mentally insane to post in these threads. Seeing /a/tards roam free in /07/ would drive anyone mad.
heh Lucky for you, I was already insane...

[Anonymous No.]

>>36454780
Why not just put them back in?
Are you an idiot?
Anyway Lion is actually Nanjo anyway.

[Anonymous No.]

>>36454832
They tried to, but nanjo messed up the process leaving her with meat flaps

[Anonymous No.]

!

[Anonymous No.]

>>36454758

[Anonymous No.]

>>36454846
Disgusting unrefined poster.

[Anonymous No.]

>anon doesn't get pic related
>(![]+[])[+!+[]]
javascript;

[Anonymous No.]

>>36454905
javascript devs aren't people

[Anonymous No.]

Who is the python of WTC?

[Anonymous No.]

>>36454905
https://ghostbin.com/paste/fCSma

[Anonymous No.]

Fuck I dropped my ovaries all over this cliff, ....I already hear the seacats pecking away at them........

[Anonymous No.]

>>36454905
>>36454923
Very very very based It's quite kino as well.

[Anonymous No.]

>>36454914
>gets filtered by the esoteric crap in javascript
>misses out on a genuinely good functional programming language.
Your loss.

[Anonymous No.]

>>36454944
>functional
Javascript is object-oriented

[Anonymous No.]

Tegaki anon, would you mind drawing next a bald Enje?

[Anonymous No.]

Nᴀᴛsᴜʜɪ ᴅᴏᴇsɴ'ᴛ ǫᴜᴇsᴛɪᴏɴ ᴛʜᴇ ɢᴇɴᴅᴇʀ ᴏғ ᴛʜᴇ ᴠᴏɪᴄᴇ ᴏɴ ᴛʜᴇ ᴘʜᴏɴᴇ
Iɴ ᴛʜᴇ ᴍᴀɴɢᴀ ᴛʜᴇ ʀᴇᴠᴇᴀʟ ᴏғ ᴛʜᴇ ɪɴᴊᴜʀʏ ɪs ᴊᴜxᴛᴀᴘᴏsᴇᴅ ᴡɪᴛʜ ᴘɪᴄᴛᴜʀᴇs ᴏғ ᴀɴ ᴀɴᴀᴛᴏᴍʏ ᴛᴇxᴛʙᴏᴏᴋ, Yᴀsᴜ ᴀɢᴏɴɪᴢɪɴɢ ᴏᴠᴇʀ ʜᴇʀ ʙᴏʏɪsʜ ʙᴏᴅʏ ᴀɴᴅ ɴᴇᴠᴇʀ ʜᴀᴠɪɴɢ ᴀ ᴘᴇʀɪᴏᴅ, ᴀɴᴅ ᴛʜᴇ ʟᴀɴɢᴜᴀɢᴇ Nᴀɴᴊᴏ ᴜsᴇs ᴀʙᴏᴜᴛ ʙᴇɪɴɢ "ᴜɴᴀʙʟᴇ ᴛᴏ ᴍᴀᴋᴇ ᴄʜɪʟᴅʀᴇɴ" ɪsɴ'ᴛ ᴛʜᴇ ʟᴀɴɢᴜᴀɢᴇ ʏᴏᴜ'ᴅ ᴜsᴇ ᴀʙᴏᴜᴛ ᴀɴ ɪɴғᴇʀᴛɪʟᴇ ᴡᴏᴍᴀɴ
Tʜᴇ ᴅᴀᴍᴀɢᴇ ᴀ ᴍᴀʟᴇ ᴄʜɪʟᴅ ᴡᴏᴜʟᴅ ʜᴀᴠᴇ ᴛᴏ sᴜsᴛᴀɪɴ ᴛᴏ ɴᴇᴠᴇʀ ɢᴏ ᴛʜʀᴏᴜɢʜ ᴘᴜʙᴇʀᴛʏ ɪs ᴀ ʟᴏᴛ ᴍᴏʀᴇ sᴜʀᴠɪᴠᴀʙʟᴇ ᴛʜᴀɴ ᴛʜᴇ ᴅᴀᴍᴀɢᴇ ᴀ ғᴇᴍᴀʟᴇ ᴄʜɪʟᴅ ᴡᴏᴜʟᴅ ʜᴀᴠᴇ ᴛᴏ sᴜsᴛᴀɪɴ. ɪɴ ᴡᴏᴍᴇɴ, ᴛʜᴇ ɢᴇɴɪᴛᴀʟs - ᴛʜᴇ ᴏᴠᴀʀɪᴇs ᴀɴᴅ ᴜᴛᴇʀᴜs - ᴀʀᴇ ʟᴏᴄᴀᴛᴇᴅ ɪɴsɪᴅᴇ ᴛʜᴇ ᴀʙᴅᴏᴍᴇɴ, ᴀɴᴅ ɴᴏᴛ ʙᴇᴛᴡᴇᴇɴ ᴛʜᴇ ʟᴇɢs, ᴀs ɪɴ ᴍᴇɴ, sᴏ ɪɴ ᴛʜᴇ ᴄᴀsᴇ ᴏғ Sᴀʏᴏ ɢɪʀʟ, ᴛʜᴇ ɢᴇɴɪᴛᴀʟs ᴄᴏᴜʟᴅ ɴᴏᴛ ʙᴇ ᴀғғᴇᴄᴛᴇᴅ ᴀᴛ ᴀʟʟ. Wʜɪᴄʜ, ʙʏ ᴛʜᴇ ᴡᴀʏ, ɪs ʟᴏɢɪᴄᴀʟ, sɪɴᴄᴇ ɪɴᴛᴇʀɴᴀʟ ᴏʀɢᴀɴs ᴄᴀɴ ʙᴇ ᴅᴀᴍᴀɢᴇᴅ ʙʏ ʜʏᴅʀᴏsᴛᴀᴛɪᴄ sʜᴏᴄᴋ ᴡʜᴇɴ ғᴀʟʟɪɴɢ ғʀᴏᴍ ᴀ ʜᴇɪɢʜᴛ, ʙᴜᴛ ᴛᴡᴏ sᴍᴀʟʟ ғᴏʟᴅs ᴀʀᴇ ɴᴏᴛ.

[Anonymous No.]

>>36454877
>>36454914
>>36454939
all filtered btw

[Anonymous No.]

Yasu's sex belongs in the catbox

[Anonymous No.]

>>36454976
Too late. I'm literally just about to shut off the computer for the night. I missed the backgammon request too.

[Anonymous No.]

>>36454944
>genuinely good functional programming language
Uhh no it's shit
the callbacks are really confusing at first

[Anonymous No.]

>>36454988
I'm not reading this but just know that Yasu is a man, in case you said otherwise.

[Anonymous No.]

>>36454994
ᴵ ʰᵃᵗᵉ ʸᵒᵘ, ᴵ ˢᶦⁿᶜᵉʳᵉˡʸ ᵈᵉˢᵖᶦˢᵉ ʸᵒᵘ. ˢᵒ ᴵ ˢᵖᵉⁿᵈ ᵉᵛᵉʳʸ ʷᵃᵏᶦⁿᵍ ᵐᵒᵐᵉⁿᵗ ᵗʳʸᶦⁿᵍ ᵗᵒ ᵐᵃᵏᵉ ʸᵒᵘʳ ᵈᵃʸ ʲᵘˢᵗ ᵃ ᵗᶦⁿʸ ᵇᶦᵗ ʷᵒʳˢᵉ. ᴵ ʷᶦˡˡ ⁿᵉᵛᵉʳ ˢᵗᵒᵖ, ᴵ ⁿᵉᵛᵉʳ ʳᵉˢᵗ.
ᴵ ᵃᵐ ᴬⁿᵍᵉ

[Anonymous No.]

>>36455040
>seething
tsdr btw

[Anonymous No.]

>>36454905
>>36454923
Decode this, jsfuck script kiddie.
>GCCGGATAGAGTGAGGACCGAAGGTCTACCGAGAGTGGGACTGAATGAAGGATAGAGTACCGCGAGCCGGGGC

[Anonymous No.]

>>36455058
Looks like Ushiromiya DNA.

[Anonymous No.]

>>36455058
[red]Uncaught ReferenceError: GCCGGATAGAGTGAGGACCGAAGGTCTACCGAGAGTGGGACTGAATGAAGGATAGAGTACCGCGAGCCGGGGC is not defined[/red]

[Anonymous No.]

>>36455065
You're not wrong. Here's something to test your decoder.
Ushiromiya = GGGGGTCTGAACGAAGGTCAGATTGATGGAAGGTAGGACG

[Anonymous No.]

>>36455084
write a script that translates each triplet to its corresponding amino acid right now
or you suck

[Anonymous No.]

i think i'd feel pretty embarrassed if i were born into some little hick town and my parents forced me to partake in its weird gimmicks

[Anonymous No.]

>>36444486
Me watching Gou and Sotsu.

[Anonymous No.]

>>36455165
You make lewd suggestive faces while watching Gou and Sotsu?

[Anonymous No.]

>>36455152
CHOP

[Anonymous No.]

>>36455170
Don't you?

[Anonymous No.]

Goodnight to all except the poster who should be banned right now.

[Anonymous No.]

>>36454970
It isn't a pure OOP language, like say C/C++
The fact that you can pass functions as parameters, makes it a functional programming language.

HOFs only exist in functional programming languages

[Anonymous No.]

Ikuko = Yasu
I REFUSE TO EXPLAIN

[Anonymous No.]

>>36454879
Why is ange making all those weird noises???

[Anonymous No.]

>>36454988
This makes sense.

[Anonymous No.]

>>36454888
You're crusin for a brusin bud

[Anonymous No.]

>>36455204
Good, now I don’t have to hide or filter your shit.

[Anonymous No.]

>>36455193
And who would that be anon?

[Anonymous No.]

>>36455038
Callbacks are in Rust as well.
Functional Programming Languages use functions for everything.

[Anonymous No.]

>>36455023
Ok no worries, have a good night

[Anonymous No.]

>>36455202
>a pure OOP language, like say C/C++

[Anonymous No.]

>>36455204
don't say that, you'll get a day vacation for spoilers

[Anonymous No.]

>>36455477
Horrendous loser.

[Anonymous No.]

>>36454244
same

[Anonymous No.]

>>36455503
What's got you so mad?

[Anonymous No.]

>>36454931
can't you put them back in?

[Anonymous No.]

>>36454988
what if Nanjo botched really hard the operation and remmoved her ovaries?

[Anonymous No.]

>>36455204
based

[Anonymous No.]

>>36451415
Understandable, have a great day!

[Anonymous No.]

>>36452084

[Anonymous No.]

Why is R07 prose so bad in japanese. It's almost unreadable

[Anonymous No.]

>>36455764
I've seen people say his prose is fine too.

[Anonymous No.]

>>36455764
Post some particularly bad examples?

[Anonymous No.]

post Bern cringing

[Anonymous No.]

>>36455469
Sorry C fag. Rust will always be better than C and C++ because it is a functional language.

[Anonymous No.]

[Anonymous No.]

[Anonymous No.]

[Anonymous No.]

[Anonymous No.]

[Anonymous No.]

>>>>/pol/337952001
Should we be worried?

[Anonymous No.]

>>36456076
kenyan nipah more like

[Anonymous No.]

>>36454186
what did you cum to

[Anonymous No.]

Deflowering Rukhshana!

[Anonymous No.]

>>36456076
These two cumrags are always messing with us, aren't they

[Anonymous No.]

>>36456179
She's this king's granddaughter, btw. The one who wrote with him in a mental tablet. Rukhshana has also received special permission to join the kette from the king of her country.

[Anonymous No.]

>>36456076
What the fuck is going on in this world? First the lambda variant then the delta variant now this? We have to spin the chessboard around to understand!

[Anonymous No.]

>>36456225
>>36456218
Enough with the cringe.

[Anonymous No.]

>>36455984
satoko should step on there

[Anonymous No.]

>>36455984
Satoko's expression is the only thing that really matters in this whole picture

[Anonymous No.]

>>36456239
Zen zen dama da...
I won't believe that this was all a coincidence! UHOOOOOOOOOOOO!

[Anonymous No.]

>>36456251
Not Rika's puffy pussy?

[Anonymous No.]

>>36456275
I couldn't notice.

[Anonymous No.]

>>36456313
Are you gay?

[Anonymous No.]

Is being a goat really a bad thing? I have tons of fun making different theories about the Rokkenjima Massacre.
I particularly like the "Battler is the culprit" theory, as it really is fun and it would make Ange suffer even more

[Anonymous No.]

>>36456332
>"Battler is the culprit"
>theory

[Anonymous No.]

I noticed that I have a hard time having any animosity towards Satoko. Whenever I saw her shoot Teppei it almost felt natural. Same thing with Keiichi, Ooishi and Rika. It's like I accepted in my mind she was just a witch having some fun. The only thing that really mesmerized me a bit was Rena's reaction. But basically, when Satoko does something deemed as awful, I react to her the same way I reacted to Beato in my reread of episodes 1 and 2 of Umineko. Like it's a natural trait she always had. I remember at least having some sort of reaction towards Takano reaching the end of Higurashi, but I cannot dislike Satoko like that for some reason. She just is. I don't process the villain part. I just see another character.

[Anonymous No.]

>>36456336
care to share how do you think the massacre happened?

[Anonymous No.]

>>36456313
No, but I think Satoko's face makes me harder than rikunny

[Anonymous No.]

>>36455764
......Post............ examples, ......please. ......In other words, ...screenshots.

[Anonymous No.]

>>36456373
Meant to quote this
>>36456321

[Anonymous No.]

>>36456373
We get it, you're gay.

[Anonymous No.]

>>36456251
Truth.
>>36456373
Same.

[Anonymous No.]

Mating press Rosa

[Anonymous No.]

maria

[Anonymous No.]

>>36456403
's cleavage

[Anonymous No.]

Dlanor

[Anonymous No.]

satokoのashi

[Anonymous No.]

>>36456391
I'm not gay though. Satoko just steals the spotlight there. Had it been Satoko crouching like that, I'd focus on Satokunny. And get even harder

[Anonymous No.]

>>36456418
's pubes

[Anonymous No.]

>>36456418
's actually a boy

[Anonymous No.]

>>36456429
>>36456432
Unfunny shitposts

[Anonymous No.]

because I'm jealous of the wit

[Anonymous No.]

[Anonymous No.]

>>36456464
Based "meeps his legs" poster

[Anonymous No.]

>>36456453
Since when are Dlanor's pubes supposed to be funny?

[Anonymous No.]

What's the first thing you notice in this image?

[Anonymous No.]

>>36456481
She’s just a kid.

[Anonymous No.]

>>36456536
Satoko's butt and backsack

[Anonymous No.]

>>36456536
Rika's panties.

[Anonymous No.]

>>36456536
Satoko's ass. It's made so people focus on it.

[Anonymous No.]

>>36456536
The fact that I’ve already seen this image

[Anonymous No.]

If Battler was the culprit, do you think he would go on a rampage like Rudolf & Kyrie, or would he kill them one by one like Yasu and Eva?

[Anonymous No.]

>>36456536
Rena-chan and Mii-chan became lolis for some reason

[Anonymous No.]

>>36456536
Rena's face

[Anonymous No.]

>>36456536
Satoko's cute face!!

[Anonymous No.]

>>36456579
You didn't read Umineko Hane?

[Anonymous No.]

>>36456582
Clearly not. They're further in the back and the angle is very low.

[Anonymous No.]

>>36456579
>If Battler was the culprit

[Anonymous No.]

>>36456579
Have I got news for you.

[Anonymous No.]

>>36456536
satokos out of frame ashi

[Anonymous No.]

Okay ill post my theory but only ants are allowed to read it

[Anonymous No.]

>>36456596
I did, but I feel like Black Battler is too much edgy and different from the real Battler, and I want to know how do you people think Battler would've had done the killing

[Anonymous No.]

>>36456654
you fool, you posted your cock size and semen count in there

[Anonymous No.]

>>36456179
anon she lost her virginity when she was 8

[Anonymous No.]

>>36456654
Just from the images, I can tell that your theory is kind of boring. But holy shit it's wordy for what it is.

[Anonymous No.]

>>36456650
But her legs are in frame.

[Anonymous No.]

>>36456654
Just from the size I can tell it's all wrong. Sotsu isn't that complex.

[Anonymous No.]

>>36456536
Rika's face

[Anonymous No.]

>>36456862
This

[Anonymous No.]

>>36456862
>>36456916
You know that some anons are proficient at writing huge walls of text about nothing in particular. Some authors you might know also like to repeat things ad nauseam. The length of a text does not correlate with its complexity.

[Anonymous No.]

>>36456949
blah blah blah

[Anonymous No.]

>>36456949
>all that text
Bruh, I really hope you don't expect me to read all that

[Anonymous No.]

Higurashi, but Hanyuu and Eua are succubi.

[Anonymous No.]

>>36457040
You mean they aren't already?

[Anonymous No.]

>>36455885
woah we got a functional autist over here

[Anonymous No.]

>>36457103
transfolx*
They're a Rustascean

[Anonymous No.]

>>36456536
Rika's pantsu followed by Satokobutt

[Anonymous No.]

>>36457040
So everyone is better off? Just having their life force drained would be a mercy compared to the bullshit they have to put up with.

[Anonymous No.]

LOL Ryukishi
Nevertheless I'm grateful for being introduced into mistery novels. Now I'm off to work out who did it.

[Anonymous No.]

>>36457040
Isn't Hanyuu already? She canonically had sex

[Anonymous No.]

Meeper meeps meep meepe meepy meep meepie meeps. Mii meep meeping meep meep meepard meep meep meeps meep Mii Niipah! meep meepey meep meeped meeps meep meep inmeepable meep meep meeps. Mii! meep meep meepy meepery, meep meeps’ meep meepency meep meep meeps meep meep meepment meep niiipah meep meep miii meeps, meep meep meep meepic miiiiii meep meep meeption meep inmeep.

Mii!s meep meep meep meep meep Mii!ling meeped meep meep meep Mii!lberg meeping meep meeps; meep meep meep meep meeps meep meeper meep meepen meep meep meep meep meep meep meept meepthing meep meepbody?meep meepusly meepable meep-meeption meep meep meeps. Mii! Mii!ry Mii!her meeps meep meep anti-Mii!tian (meep meep), meep meep’s meeply meep anti-Mii!es Mii!nd meeps meep meeps meep meep meep, meepty meep meepment. Mii! meep meeps meep meep meep meep. Mii!, meepfully, meep meep meeper meep meep.

>d-meep meepst meep meeps meep meep meepough d-meep fucking useless Hanyuu.
"Mii!!"
Mii! meeping meep meepful; meep meep meep meepble. Mii! meep meep, Mii! meeped meep meepry meep meep meeper meep meep meep meep, meep meepor meep meeptead meep meep meeper "meeped meep meeps."

Mii! meep meeping meep meep meep meep meep meep meepry meep meep meep meep meeped. Mii! meeped meep meep Mii! meep meeped meep meep meepal meep meeps. Mii! meep meeplous. Mii!ling's meep meeps meep meeped meep meepes meep meep meeps meep meep meep meep meep meep meep meeping. Mii! Mii! meep meep meepish, meeping meep meep Mii!ry Mii!her meep meep meep Mii!phen Mii!ng. Mii! meep meepthing meep meep meepect meep, "Mii! meepse meeps meep meeping Mii!ry Mii!her meep meepmeep meep meepmeep, meep meep meep meep meeper meep meep meep meep meep meep Mii!phen Mii!ng." Mii! meep meep meep meepght. Mii! meep meep meeping meepic. Mii! meep meep "Mii!ry Mii!her" meep meep, meep meep, meeped meep meep Mii!phen Mii!ng.

[Anonymous No.]

Click

[Anonymous No.]

if the gauntlet knights are the pieces, who are the players?

[Anonymous No.]

>>36457488
Isn't it obvious

[Anonymous No.]

>>36457488

[Anonymous No.]

>>36457488
Mitsuyo and Vier.

[Anonymous No.]

>>36457495
Why are all those Sotsugou edits fucking cringe?

[Anonymous No.]

>>36457604
Sotsugou is cringe, Ciconia is cringe, combine them and you get a cringe overdose.

[Anonymous No.]

>>036457604
>Sotsugou
It's sotsugyou

[Anonymous No.]

sucksogood

[Anonymous No.]

>>36457634
It's 「ひぐらしのなく頃に 業/卒」

[Anonymous No.]

>>36456536
I don't get this fetish, does the artist like pube sunburns or something

[Anonymous No.]

[Anonymous No.]

DO NOT REDEEM NANODESU

[Anonymous No.]

>>36458804
heh

[Anonymous No.]

>>36458015
Most delightful pussy in the WTC franchise.

[Anonymous No.]

>>36458015
INTJ, just like me

[Anonymous No.]

>>36459182
How would you know?

[Anonymous No.]

>>36434947

[Anonymous No.]

[Anonymous No.]

>>36459275
imagine making a thread just to whine.

[Anonymous No.]

>>36455764
you just don't understand japanese

[Anonymous No.]

What sort of outfit should I force Enje to wear? I'm half awake right now so if I close my eyes I'm back in my lucid dream.

[Anonymous No.]

>>36457499
how does he do it?

[Anonymous No.]

>>36459408
ask ryukishi.

[Anonymous No.]

>>36459403
shimapan bottom
mcdonalds uniform top, hat included

[Anonymous No.]

>>36459403
Cow bikini

[Anonymous No.]

>>36459278
Reminder that Miyao has a vagina.

[Anonymous No.]

>>36459471
>Miyao is trans just like me
Incredible projection.

[Anonymous No.]

>>36459491
The body belongs to Myao, but Miyao is allowed to exists as her DID friend for shits and giggles.

[Anonymous No.]

[Anonymous No.]

>>36459471
Kissing Miyao's womb!

[Anonymous No.]

>>36456654
Post the full theory bro!

[Anonymous No.]

>>36459911
My theory is that Okonogi is the culprit.

[Anonymous No.]

>>36460046
I remember reading a image showing all the evidence for Okonogi and it made good sense.

[Anonymous No.]

Okonogi is the culprit of Higurashi
Okonogi is the culprit of Uminekino
So he must also be the culprit of Ciconia

[Anonymous No.]

Okonogi is the single element

[Anonymous No.]

>>36456239
To end the cringe is to end this general.

[Anonymous No.]

It's my dream to one day own this island: https://www.youtube.com/watch?v=SBWVKP9EdR0 and begin a dynasty of my own, so that one day I can have them all killed in the greatest murder mystery of all time!

[Anonymous No.]

>>36457484
ToT

[Anonymous No.]

>>36460146
Then the cringe will never end...

[Anonymous No.]

Goodnight bros, tomorrow let's shitpost together!

[Anonymous No.]

>>36460263
Burn in hell sperg

[Anonymous No.]

Which one of you did this

[Anonymous No.]

>>36460300
burn is four letters so what you were really trying to say is
"Love uu broo sperg"
Thanks bro :)

[Anonymous No.]

>>36460301
I did! sorry! hahaha!
(Whats a private tracker???)

[Anonymous No.]

>>36460313
Yeah, I love you Sperg don't listen to them! Keep trolling newfags!

[Anonymous No.]

>>36460322
B-B-BASED!!!

[Anonymous No.]

>>36460321
sekrit club that only the cool kids can access
literally the most pointless shit ever

[Anonymous No.]

>>36460321
A place you can become really obnoxious at and pirate shit, but you need invites

[Anonymous No.]

>>36460351
Oh, like torrent trackers, but private? What's the big difference?

[Anonymous No.]

>pirate shit
anyone got a link to download switch's higurashi games

[Anonymous No.]

>>36460344
So what is it they do? Do they track other anons in private like it's a game or something and upload their photos in the thread?
>>36460351
That sounds really sketchy!

[Anonymous No.]

>>36460356
They have shit you can't find on public ones, sometimes. Also you gotta seed your shit or you get kicked.

[Anonymous No.]

>>36460359
Is it even possible to pirate console games online?

[Anonymous No.]

>>36460369
You can even emulate switch games, of course you can

[Anonymous No.]

>>36460361
>Do they track other anons in private like it's a game or something and upload their photos in the thread?
Nah it's basically nyaa except it's private
you have a seeding quota each month, if you fail to reach it you'll get banned (or so I heard)
Private trackers might become actually reasonable in the next decade as piracy gets harder and harder but for now they're pointless.

[Anonymous No.]

>>36460379
Woah the future is getting pretty cool!

[Anonymous No.]

>>36460385
Oh, That sounds a lot lamer than what I thought it was.

[Anonymous No.]

>>36460301
based

[Anonymous No.]

what version of higurashi has the best sprites

[Anonymous No.]

>>36460470
Ps3 then original. Final awnser

[Anonymous No.]

>>36460470
Console=OG>Steam/pachinko guy art. I'd say OG is overall better but console has more variety in expressions and characters.

[Anonymous No.]

Reminder to all fucking pedos in these threads who think it's okay to sexualize children! Satoko and Rika ARE CHILDREN!

[Anonymous No.]

Call me a pedo, call me a milfhunter, call me whatever you want, I'll sexualize sexy older women, children, babies, your family, your children, your sister, your mother, my mother, my children, my sister, my aunt, my grandma, your grandma and release huge ropes of seed while thinking about raping them day and night.

[Anonymous No.]

>>36460818
Kinda cringe, But also kinda based

[Anonymous No.]

reddit expansion

[Anonymous No.]

>>36459275
Thanks

[Anonymous No.]

>>36460470
Steam, then original.

[Anonymous No.]

Just finished episode 8 of Umineko.
what now?

[Anonymous No.]

>>36461033
Leave these threads.
Don’t come back.

[Anonymous No.]

>>36461058
alright then

[Anonymous No.]

I don't mind some lewdposting but lastly it often makes more than 50% of a thread. Thats just degenerate.

[Anonymous No.]

>>36461064
yeah it's been kinda horny in here for a few days

[Anonymous No.]

Satoko's imouto juices

[Anonymous No.]

Haa... come here, Child of Man...

[Anonymous No.]

[Anonymous No.]

>>36456367
I'm just sad and disappointed that Ryuukishi made her go through this.

[Anonymous No.]

>>36457499
Are they twin brothers?

[Anonymous No.]

ITALIANON HERE
A JAPANESE GUY LIKED MY TWEET
IS HAPPENING

[Anonymous No.]

>>36461161
the witch of sexual pleasure

[Anonymous No.]

>>36461161
>>36461639
Pedo fuck off

[Anonymous No.]

>>36461639
Strange that other witches in Ryuukishi's works don't even have magic wands. She must be the most powerful one.

[Anonymous No.]

>>36461683
What about the Ushiromiya staff? Those are acceptable.

[Anonymous No.]

>>36461683
>>36461707
BECAUSE A WITCH IS ANOTHER VERSION OF A REAL EVENT

[Anonymous No.]

>>36453194

[Anonymous No.]

>>36461707
I don't know, they aren't actual Magic Wands

[Anonymous No.]

>>36461812
I'm impressed that the artist actually made it look like an actual Magic Wand and not like those generic ones that look different.

[Anonymous No.]

>2021
>still do not belive i Erikantrice

Why faggots here so cringe?

[Anonymous No.]

>>36461909
>her

[Anonymous No.]

>>36461161
I want to protect this smile

[Anonymous No.]

>>36461941
HER
SHANON IS NOT BEATRICE NORMIE

AND BEATRICE IS A WOMAN
WHY?

KINZO WAS AFRAID TO COMMIT THE SAME SIN AGAIN
A MAN CAN'T GET PREGNANT SO YASU IS FEMALE

[Anonymous No.]

Man, I thought my plan was perfect, but no, he's here

[Anonymous No.]

Filters on!

[Anonymous No.]

>>36461683
But Maria and EVAtrice have one, and Beato's pipe is her wand

[Anonymous No.]

I don't even show stubs, the filter hides the posts completely. It's wonderful!

[Anonymous No.]

Are backgrounds in Mei the same as console ports just sometimes with filters or did they redraw them? Or literally the same as alchemists backgrounds? I'm fucking blind

[Anonymous No.]

>>36462039
FUCKING KEK

[Anonymous No.]

>>36462040
geiichi

[Anonymous No.]

>>36462033
See >>36461812

[Anonymous No.]

>>36462040
AFAIK they are the same. Honestly Mei sprites don't look that bad with those backgrounds.

[Anonymous No.]

MOOOOOOOOOOOOOOOOOOOOOO

[Anonymous No.]

>>36462214
Did you know? If you type Nii-Nii, but accidentally one row to the right, it's Moo-Moo

[Anonymous No.]

>>36462247
Ryukishi is a fucking genius. He planned for Satocow from the start.

[Anonymous No.]

Moo Moo! Moo Moo!

[Anonymous No.]

>>36462214
>>36462247
>>36462261
FUCK OFF COOMERS AND READ HERE THE MANIFESTO
https://www.docdroid.net/lnzdHQc/erikantrice-manifesto-pdf

[Anonymous No.]

Cowtoko or Satocow
Which sounds nicer?

[Anonymous No.]

>>36462292
Satocow always

[Anonymous No.]

>>36462214
We know Cowtoko >>36447443

[Anonymous No.]

>>36462292
Satocow.