/07/th Expansion Thread

File: 170 KB, 1600x1200, 1610231733246.jpg [View same] [iqdb] [saucenao] [google]

/07/th Expansion Thread Anonymous Mon Sep 6 01:21:26 2021 No.36443598 [Reply] [Original]

Discussion concerning Higurashi, Umineko, Ciconia, Rose Guns Days, Higanbana, TRianThology, Haworthia and all other 07th Expansion works.

07th Expansion archive:
https://mega.nz/folder/wLxAFApJ#bw2evoJRzl6BDhlpadX1YQ
(Dead at the moment, backup torrent(?) soon)

Umineko colored truths script:
https://controlc.com/27143a5a

Scorpion Charm:
https://pastebin.com/aa9NjGdU

Image-Based Scorpion Charm:
https://pastebin.com/G5xm1rbQ

Previous Thread: >>36420800

>>	Anonymous Mon Sep 6 01:26:29 2021 No.36443653 >>36443598 god

>>	Anonymous Mon Sep 6 01:30:42 2021 No.36443694 >>36443598 Why would you make a new thread while the old one is still up you fucking moron?

>>	Anonymous Mon Sep 6 01:36:38 2021 No.36443759 Can someone link an unpatched version of Saku?

>>	Anonymous Mon Sep 6 01:38:29 2021 No.36443779 >>36443759 Sure here you go lol http://www.lemonparty.tv/

>>	Anonymous Mon Sep 6 02:48:18 2021 No.36444386 >>36443779 thanks

>>	Anonymous Mon Sep 6 02:50:28 2021 No.36444402 >>36443598 Is that ona for Satoko?

>>	Anonymous Mon Sep 6 02:50:38 2021 No.36444403 Fuck me. I go away for like 6 mths and when I come back YOU FAGS ARE STILL HERE

>>	Anonymous Mon Sep 6 02:50:55 2021 No.36444405 >>36444403 bye

>>	Anonymous Mon Sep 6 02:51:34 2021 No.36444411 >>36444403 >Fuck me. Ew, no thanks.

>>	Anonymous Mon Sep 6 02:52:19 2021 No.36444417 >>36444403 Suicide is the only way to escape from here anon.

>>	Anonymous Mon Sep 6 02:52:41 2021 No.36444421 beato paizuri

>>	Anonymous Mon Sep 6 03:00:19 2021 No.36444478 File: 64 KB, 1000x563, p_006.jpg [View same] [iqdb] [saucenao] [google] Previews are up.

>>	Anonymous Mon Sep 6 03:01:01 2021 No.36444486 File: 673 KB, 1000x563, file.png [View same] [iqdb] [saucenao] [google] bored

>>	Anonymous Mon Sep 6 03:01:20 2021 No.36444488 File: 64 KB, 1000x563, p_001.jpg [View same] [iqdb] [saucenao] [google]

>>	Anonymous Mon Sep 6 03:02:21 2021 No.36444493 >>36444486 This looks like it could be edited to be more erotic.

>>	Anonymous Mon Sep 6 03:03:22 2021 No.36444500 File: 74 KB, 1000x563, p_005.jpg [View same] [iqdb] [saucenao] [google]

>>	Anonymous Mon Sep 6 03:04:23 2021 No.36444506 File: 40 KB, 1000x563, p_003.jpg [View same] [iqdb] [saucenao] [google]

>>	Anonymous Mon Sep 6 03:07:45 2021 No.36444528 no chink leaks allowed!

>>	Anonymous Mon Sep 6 03:08:12 2021 No.36444532 >>36444488 This is probably a flashback to baby Rika.

>>	Anonymous Mon Sep 6 03:09:14 2021 No.36444539 >>36444528 This is the chinese century, comrade. Better start learning Mandarin.

>>	Anonymous Mon Sep 6 03:11:34 2021 No.36444552 >>36444528 Why did the jannoids feel the need to delete this anons post?

>>	Anonymous Mon Sep 6 03:13:02 2021 No.36444560 >>36444552 probably because they didn't, rather, he deleted it himself after realizing that these weren't chink leaks.

>>	Anonymous Mon Sep 6 03:16:44 2021 No.36444598 File: 335 KB, 2048x2208, E-kjcLGVUAEMMFI.jpg [View same] [iqdb] [saucenao] [google] >>36444486 >>36444488

>>	Anonymous Mon Sep 6 03:26:21 2021 No.36444680 File: 3.23 MB, 2000x2000, 92549550_p0.jpg [View same] [iqdb] [saucenao] [google]

>>	Anonymous Mon Sep 6 03:30:23 2021 No.36444720 Is there any chance the Mega archive will be revived?

>>	Anonymous Mon Sep 6 03:32:45 2021 No.36444739 >>36444720 No, It's over

>>	Anonymous Mon Sep 6 03:45:30 2021 No.36444823 File: 2.23 MB, 1601x1239, copetard.png [View same] [iqdb] [saucenao] [google] >witches are just copetards HOW WILL MAGIC KEKS EVER RECOVER?!?!?1

>>	Anonymous Mon Sep 6 03:48:15 2021 No.36444843 >>36444823 We can't.... We fucking can't okay!...

>>	Anonymous Mon Sep 6 03:49:38 2021 No.36444853 File: 1.06 MB, 114x114, 1616575046427.gif [View same] [iqdb] [saucenao] [google] Rika be like

>>	Anonymous Mon Sep 6 03:51:17 2021 No.36444868 >>36444853 wtf

>>	Anonymous Mon Sep 6 03:53:31 2021 No.36444880 >>36444853 KEK XD I REALLY REALLY LOVED HOW YOU POSTED THE SAME EXACT POST IN THE LAST THREAD XD YOU SHOULD MAKE THIS THE /07/ RITUAL POST XDDD JUST LIKE /a/!!!!!

>>	Anonymous Mon Sep 6 03:55:26 2021 No.36444893 File: 52 KB, 450x600, __dlanor_a_knox_umineko_no_naku_koro_ni_drawn_by_em_crazy__d3c7192f843e428312c36077f0274305.jpg [View same] [iqdb] [saucenao] [google] she cute

>>	Anonymous Mon Sep 6 03:56:17 2021 No.36444901 >>36444893 she looks like she fucks the edges of tables

>>	Anonymous Mon Sep 6 03:56:40 2021 No.36444905 File: 190 KB, 392x447, 1618015242506.png [View same] [iqdb] [saucenao] [google] >>36444893 Yes! She is!

>>	Anonymous Mon Sep 6 03:56:46 2021 No.36444907 File: 48 KB, 391x186, 1630671796817.png [View same] [iqdb] [saucenao] [google] eh is this wow wow thing something that all arab girls say?

>>	Anonymous Mon Sep 6 03:58:36 2021 No.36444917 File: 311 KB, 1668x1668, erika dlanor20.jpg [View same] [iqdb] [saucenao] [google] >>36444893 yes.

>>	Anonymous Mon Sep 6 03:59:13 2021 No.36444921 File: 123 KB, 1000x1000, Dlanoriscute!.jpg [View same] [iqdb] [saucenao] [google] Dlanor is cute! CUTE!

>>	Anonymous Mon Sep 6 04:00:10 2021 No.36444929 Day 52 of praying for RGD adaptation.

>>	Anonymous Mon Sep 6 04:01:47 2021 No.36444938 >>36444488 This is teh Umineko mansion staircase guys

>>	Anonymous Mon Sep 6 04:02:15 2021 No.36444946 File: 647 KB, 1300x1500, Cute!.jpg [View same] [iqdb] [saucenao] [google] >>36444907 Only the cute ones!

>>	Anonymous Mon Sep 6 04:05:55 2021 No.36444970 File: 79 KB, 1088x737, killme.png [View same] [iqdb] [saucenao] [google] Do you guys ever have a theory that sounds cool on your head but seems kinda silly when you write it out?

>>	Anonymous Mon Sep 6 04:07:24 2021 No.36444982 >>36444970 theories are cringe.

>>	Anonymous Mon Sep 6 04:08:36 2021 No.36444994 >>36444970 post it anon I want to see your ciconia theory

>>	Anonymous Mon Sep 6 04:08:50 2021 No.36444995 >>36444970 Not but I wish everyone felt that because most WTC theories suck so bad

Anonymous Mon Sep 6 04:10:08 2021 No.36445011

>>36444970
Don't worry anon, That's normal. When writing a lot you may feel a whole lot of cringe over what you've just written down. When you feel like that take a break and let it stew for a bit while reflecting on the purpose of your writings. I just want you to know I'll read it even if you think it's cringe.

>>	Anonymous Mon Sep 6 04:11:19 2021 No.36445020 >>36444486 she looks like Frieza...

>>	Anonymous Mon Sep 6 04:21:51 2021 No.36445089 >>36444994 I'll probably post it tomorrow after I've had a chance to proofread a bit.

>>	Anonymous Mon Sep 6 04:41:09 2021 No.36445289 >>36444823 >M-MAGIC IS REAL, I'M NOT COPING!!!!

>>	Anonymous Mon Sep 6 04:43:02 2021 No.36445311 >Akasaka and Takano in previews Uhhh what?

>>	Anonymous Mon Sep 6 04:44:05 2021 No.36445320 >>36445311 Akasaka and the Satoko shot are clearly from Neko's first world. The confusing part is Takano. Maybe she's part of a large flashback from Hanyuu about Rika's life?

>>	Anonymous Mon Sep 6 04:48:42 2021 No.36445361 Tomita -> Tomitake Okamura -> Akasaka

>>	Anonymous Mon Sep 6 04:50:11 2021 No.36445378 >>36445361 wow haven't seen this mentioned 50 times before or anything.

>>	Anonymous Mon Sep 6 04:51:13 2021 No.36445383 File: 227 KB, 1200x675, E-k3Rc7VUAYi7DT.jpg [View same] [iqdb] [saucenao] [google]

>>	Anonymous Mon Sep 6 05:01:07 2021 No.36445448 >>36445383 I hate to see them portrayed as friends, it feels completely dishonest to their character arcs and makes light of Rika's suffering.

>>	Anonymous Mon Sep 6 05:03:23 2021 No.36445464 >>36445448 Except Sotsugou doesn't happen in Mei.

>>	Anonymous Mon Sep 6 05:08:18 2021 No.36445493 >>36445448 without love it ca

Anonymous Mon Sep 6 05:15:27 2021 No.36445531

>>36445464
My guy, it literally doesn't matter. We now know what kind of person Satoko truly is and I hate to see her act all affectionate towards Rika.
It's the same as Kyrie calling Battler a good boy in one game while contemplating to brutally kill him in the next one.

Anonymous Mon Sep 6 05:20:49 2021 No.36445555
File: 1.81 MB, 1802x1024, 1626768370969.png [View same] [iqdb] [saucenao] [google]

>>36445531
Satoko isn't like that from the get go, she becomes like that after certain events in Gou, namely her bad experience at St Lucia and Eua turning her into a looper. These events don't happen in Mei. In fact, Mei's version of St Lucia has Rika stay close to her all the time, so Satoko stays happy.

>>	Anonymous Mon Sep 6 05:32:44 2021 No.36445624 I dislike both Rika and Satoko

>>	Anonymous Mon Sep 6 05:35:30 2021 No.36445639 >>36445624 https://www.youtube.com/watch?v=5hR5YNqE3K8

>>	Anonymous Mon Sep 6 05:38:00 2021 No.36445650 >>36445639 Mad

>>	Anonymous Mon Sep 6 05:40:00 2021 No.36445659 >>36443598 Uuuuuuuuuuuuuuuuooooooooooooooooooooooh

>>	Anonymous Mon Sep 6 05:56:55 2021 No.36445746 >>36445555 Satoko was pretty eager to kill Rika in her first loop though.

>>	Anonymous Mon Sep 6 06:00:36 2021 No.36445764 >>36444994 don't post it anon you might get laughed at

>>	Anonymous Mon Sep 6 06:04:40 2021 No.36445785 Don't we have an archive?

>>	Anonymous Mon Sep 6 06:07:29 2021 No.36445803 >>36444403 It's horrible, the only good thing here is mysteries, well actually they're not even HERE

Anonymous Mon Sep 6 06:11:32 2021 No.36445824
File: 141 KB, 348x480, lam_odorokia2.png [View same] [iqdb] [saucenao] [google]

I just woke up from a dream where I struck a chuuni pose, shouted an incantation and then Lambdadelta's breasts grew very large. Afterwards she gave me a clothed paizuri and her chest returned to its original size

>>	Anonymous Mon Sep 6 06:14:00 2021 No.36445832 >>36445824 That wasn't a dream

>>	Anonymous Mon Sep 6 06:17:35 2021 No.36445854 >>36445832 That would mean that I have real magic powers.

>>	Anonymous Mon Sep 6 06:23:04 2021 No.36445881 magic is not real

>>	Anonymous Mon Sep 6 06:25:46 2021 No.36445893 magic is real

>>	Anonymous Mon Sep 6 06:35:51 2021 No.36445941 not magic isn't unreal

>>	Anonymous Mon Sep 6 06:48:00 2021 No.36446017 magic is real if you believe in it

>>	Anonymous Mon Sep 6 06:55:07 2021 No.36446062 Do you think there's no loop in which Takano could check for missing h173 samples?

>>	Anonymous Mon Sep 6 06:57:01 2021 No.36446072 >>36446062 dunno but I wish there was a loop where she gave me a handjob.

>>	Anonymous Mon Sep 6 06:58:04 2021 No.36446082 >>36446072 Don't we all

>>	Anonymous Mon Sep 6 07:03:46 2021 No.36446123 File: 15 KB, 400x400, tegaki.png [View same] [iqdb] [saucenao] [google] I'm bored. Tell me what to draw.

>>	Anonymous Mon Sep 6 07:04:43 2021 No.36446128 >>36446123 Ange, Shion and JK Satoko at a bar, depressed.

>>	Anonymous Mon Sep 6 07:05:42 2021 No.36446138 >>36446123 Patchouli and Mion kissing each other

>>	Anonymous Mon Sep 6 07:07:34 2021 No.36446148 >>36446123 satoko footjobbing me

>>	Anonymous Mon Sep 6 07:10:24 2021 No.36446166 >>36446123 Frederica Bernkastel saving Gousotsu

>>	Anonymous Mon Sep 6 07:15:08 2021 No.36446191 I'm bored. Tell me what to do with my life.

>>	Anonymous Mon Sep 6 07:15:17 2021 No.36446192 >>36444486 Eua getting ready for that cumshot

>>	Anonymous Mon Sep 6 07:15:36 2021 No.36446194 >>36446191 Draw porn

>>	Anonymous Mon Sep 6 07:16:32 2021 No.36446198 >>36446191 learn to draw so you can draw for us.

>>	Anonymous Mon Sep 6 07:17:13 2021 No.36446201 File: 18 KB, 400x400, tegaki.png [View same] [iqdb] [saucenao] [google] >>36446128

>>	Anonymous Mon Sep 6 07:18:05 2021 No.36446208 >>36446201 Thanks.

>>	Anonymous Mon Sep 6 07:20:09 2021 No.36446222 >>36446123 Rika secretly using the St. Lucia money for shady breast-enlargement treatments.

>>	Anonymous Mon Sep 6 07:20:17 2021 No.36446223 >>36446123 Sakutaro and Lucifer in bed

>>	Anonymous Mon Sep 6 07:20:18 2021 No.36446224 I'm bored. Tell me what to do with my wife Hanyuu.

>>	Anonymous Mon Sep 6 07:21:38 2021 No.36446236 >>36446224 Give her to me so I can sink her head in with a hammer.

>>	Anonymous Mon Sep 6 07:24:57 2021 No.36446250 >>36446224 play with her feet

>>	Anonymous Mon Sep 6 07:31:14 2021 No.36446291 File: 24 KB, 400x400, tegaki.png [View same] [iqdb] [saucenao] [google] >>36446138

>>	Anonymous Mon Sep 6 07:32:37 2021 No.36446302 >>36446291 wtf cute good job

>>	Anonymous Mon Sep 6 07:34:39 2021 No.36446311 >>36446291 They are supposed to be kissing each other. But this is cuter.

>>	Anonymous Mon Sep 6 07:42:21 2021 No.36446363 File: 150 KB, 1920x1080, satoko (2).jpg [View same] [iqdb] [saucenao] [google] >>36444478 Oh it's this.

>>	Anonymous Mon Sep 6 07:47:58 2021 No.36446399 >>36446363 Yeah, I'm glad all my Satocoins were sold in january. There are some poor folks now, lads.

>>	Anonymous Mon Sep 6 07:49:18 2021 No.36446406 So are they really gonna waste time on Nekodamashi loops? With 4 episodes left?

>>	Anonymous Mon Sep 6 07:50:24 2021 No.36446414 >>36446406 Duh, what are they supposed to do, skip them? If they didn't skip the other damashis, they won't skip this one.

>>	Anonymous Mon Sep 6 07:52:10 2021 No.36446426 >>36446406 Well yeah, we'll end on Nekodamashi 5 and continue next season.

>>	Anonymous Mon Sep 6 07:52:35 2021 No.36446430 >>36446414 Sort of? Do we need to know the specifics of how Satoko injected Kimiyoshi? Do we need to see her put on an evil smile and witch eyes for the 675th time?

>>	Anonymous Mon Sep 6 07:52:51 2021 No.36446432 File: 22 KB, 400x400, tegaki.png [View same] [iqdb] [saucenao] [google] >>36446148

>>	Anonymous Mon Sep 6 07:54:17 2021 No.36446440 >>36446430 Again, if we didn't skip the previous damashis we're not skipping this one, period.

>>	Anonymous Mon Sep 6 07:54:19 2021 No.36446441 File: 30 KB, 400x400, with text.png [View same] [iqdb] [saucenao] [google] >>36446148 With text

>>	Anonymous Mon Sep 6 07:55:18 2021 No.36446447 >>36446426 Gou season 3: golf holes

>>	Anonymous Mon Sep 6 07:55:27 2021 No.36446448 >>36446432 >>36446441 nice

>>	Anonymous Mon Sep 6 07:56:19 2021 No.36446458 File: 226 KB, 1448x2048, E8myXw-VoAYYFJO.jpg [View same] [iqdb] [saucenao] [google]

>>	Anonymous Mon Sep 6 07:56:50 2021 No.36446461 >>36446432 >>36446441 Bejita...

>>	Anonymous Mon Sep 6 07:57:39 2021 No.36446466 File: 2.84 MB, 1680x2376, 3309219016681b51ccd50a05294e5415.jpg [View same] [iqdb] [saucenao] [google] Let's begin this fragment with a positive vibe

>>	Anonymous Mon Sep 6 07:58:07 2021 No.36446468 >>36446447 Who's playing golf?

>>	Anonymous Mon Sep 6 07:58:53 2021 No.36446471 File: 138 KB, 600x480, but_komarub1.png [View same] [iqdb] [saucenao] [google] >>36446466 >over 100 posts in Dumb Beatranny

>>	Anonymous Mon Sep 6 07:58:59 2021 No.36446472 File: 149 KB, 1920x1080, E-kyRF5UcAQKiX9.jpg [View same] [iqdb] [saucenao] [google] >>36444488

>>	Anonymous Mon Sep 6 07:59:50 2021 No.36446478 >>36446426 I don't like the idea putting a whole season of needless padding in the middle.

>>	Anonymous Mon Sep 6 08:00:01 2021 No.36446480 File: 167 KB, 1920x1080, E-kyRRiVUAEB0Hp.jpg [View same] [iqdb] [saucenao] [google]

>>	Anonymous Mon Sep 6 08:01:02 2021 No.36446488 File: 144 KB, 1920x1080, E-kyRdBVkAIDfxD.jpg [View same] [iqdb] [saucenao] [google] >>36444506

>>	Anonymous Mon Sep 6 08:01:49 2021 No.36446493 File: 188 KB, 496x480, Bea_aserua2.png [View same] [iqdb] [saucenao] [google] >>36446471 Please no bullying, I was out late last night

>>	Anonymous Mon Sep 6 08:03:29 2021 No.36446502 File: 167 KB, 654x368, rika stroke.webm [View same] [iqdb] [saucenao] [google]

>>	Anonymous Mon Sep 6 08:07:26 2021 No.36446518 File: 236 KB, 1600x900, Abrogation.png [View same] [iqdb] [saucenao] [google]

>>	Anonymous Mon Sep 6 08:09:46 2021 No.36446535 File: 18 KB, 400x400, tegaki.png [View same] [iqdb] [saucenao] [google] >>36446166

>>	Anonymous Mon Sep 6 08:11:26 2021 No.36446543 >>36446535 Based.

>>	Anonymous Mon Sep 6 08:12:38 2021 No.36446547 How can r07 save Sotsugou?

>>	Anonymous Mon Sep 6 08:13:03 2021 No.36446553 >>36446547 Slapping Satoko

>>	Anonymous Mon Sep 6 08:13:39 2021 No.36446555 >>36446553 That'd be a terrible resolution.

>>	Anonymous Mon Sep 6 08:13:41 2021 No.36446556 >>36446547 It doesn't need to be saved

>>	Anonymous Mon Sep 6 08:13:51 2021 No.36446558 >>36446502 Looks like you have to calm down your autistic daughter, Rika, she's doing that hand flapping thing again

>>	Anonymous Mon Sep 6 08:14:01 2021 No.36446561 >>36446547 Introduce Tamurahime no Mikoto

>>	Anonymous Mon Sep 6 08:15:00 2021 No.36446564 >>36446547 Hardcore lesbian sex.

>>	Anonymous Mon Sep 6 08:16:00 2021 No.36446569 >>36446561 I dun play touhou

>>	Anonymous Mon Sep 6 08:16:01 2021 No.36446570 >>36446502 Rika has parkinsons!

>>	Anonymous Mon Sep 6 08:23:58 2021 No.36446601 >>36446547 Unrecoverable

>>	Anonymous Mon Sep 6 08:25:15 2021 No.36446613 >>36446478 Technically true, but it's preferable to having Sotsu as the conclusion.

>>	Anonymous Mon Sep 6 08:25:26 2021 No.36446615 >>36446472 Rika was magic to begin with and could see Hanyuu straight away. But this is irrelevant now as Satoko can see her too even though she had no special powers to begin with. Eua can override everything. Ryukishi a hack.

Anonymous Mon Sep 6 08:26:35 2021 No.36446630

I think it's difficult to save Sotsugou. In 4 episodes there's nothing much to recover. In a new season you would have to wonder why they need 3 fucking seasons. It's not gonna get more than 15 episodes apparently because it's not scheduled that way. I don't expect to be impressed.

>>	Anonymous Mon Sep 6 08:28:48 2021 No.36446637 >>36446613 I just think it's dumb to have to wait til 2022 for a resolution. But then again there are people who are waiting until then, or later on, for phase 2.

>>	Anonymous Mon Sep 6 08:28:58 2021 No.36446638 >>36446615 What's wrong with turning someone else into a looper just like Rika? It's like complaining that there's more than one witch in Umineko.

>>	Anonymous Mon Sep 6 08:30:31 2021 No.36446648 >>36446615 Everyone could see Hanyuu when they were ghosts at the end of Minagoroshi.

>>	Anonymous Mon Sep 6 08:45:41 2021 No.36446750 Higurashi x Muv Luv crossover

>>	Anonymous Mon Sep 6 08:58:32 2021 No.36446832 >>36446637 People wait way longer for new seasons, and we even had Sotsu inbetween. Just wait until you've been in the anime community for a few years, a wait like this is nothing.

>>	Anonymous Mon Sep 6 09:00:31 2021 No.36446853 >>36446638 I’m saying it’s poorly handled. Rika was meant to be unique from birth with special powers. Hanyuu didn’t give her them.

>>	Anonymous Mon Sep 6 09:01:52 2021 No.36446864 >>36446638 I’m talking about the ability to see Hanyuu not the looping.

>>	Anonymous Mon Sep 6 09:04:06 2021 No.36446886 File: 124 KB, 352x480, when they cry.png [View same] [iqdb] [saucenao] [google] I lost my battler with shotgun pic

>>	Anonymous Mon Sep 6 09:04:44 2021 No.36446891 File: 23 KB, 400x400, tegaki.png [View same] [iqdb] [saucenao] [google] >>36446222

>>	Anonymous Mon Sep 6 09:05:20 2021 No.36446901 >>36446891 Nice.

>>	Anonymous Mon Sep 6 09:05:50 2021 No.36446906 File: 687 KB, 1905x2100, butgl_defa1.png [View same] [iqdb] [saucenao] [google] >>36446886 This one?

>>	Anonymous Mon Sep 6 09:16:04 2021 No.36446993 >>36446906 battler's trousers are so awful

>>	Anonymous Mon Sep 6 09:20:16 2021 No.36447024 >>36444488 For whatever reason are we getting this flashback in the next episode? Now things are getting interesting.

>>	Anonymous Mon Sep 6 09:22:12 2021 No.36447041 File: 1.70 MB, 1920x1080, hmu.jpg [View same] [iqdb] [saucenao] [google] >>36447024 It's unexpected at least. I still want to know what the fuck this means though.

>>	Anonymous Mon Sep 6 09:23:33 2021 No.36447045 >>36444907 Yeah, just like all japanese girls go 'meep meep' Nevermind the fact that both are bad localizations.

>>	Anonymous Mon Sep 6 09:24:57 2021 No.36447055 Yui Horie saying wow wow wow

>>	Anonymous Mon Sep 6 09:28:16 2021 No.36447077 >>36446414 This isn't Nekoakashi.

>>	Anonymous Mon Sep 6 09:30:50 2021 No.36447097 >>36446123 Ange, JK Satoko, and a literal COW beside each other, then any character you want from WTC say while looking at them "I see no difference"

>>	Anonymous Mon Sep 6 09:33:36 2021 No.36447118 >>36447041 It's just ひ for ひぐらし。

>>	Anonymous Mon Sep 6 09:34:38 2021 No.36447130 >>36447055 She almost does, it's not like hauau is far from wauwau.

>>	Anonymous Mon Sep 6 09:38:43 2021 No.36447163 >>36446441 Based

>>	Anonymous Mon Sep 6 09:47:58 2021 No.36447253 File: 21 KB, 400x400, tegaki.png [View same] [iqdb] [saucenao] [google] >>36446223

>>	Anonymous Mon Sep 6 09:51:35 2021 No.36447274 Tegakianon never once drew a Higanbana character

Anonymous Mon Sep 6 09:58:04 2021 No.36447337

Sotsu episode 12 synopsis: We're going to see a bit of Hanyuu's POV as she something something to give Rika that memory boon. Eua is not entertained. Satoko gets the sword. Rika does not dance. Rush to Akasaka's murder-rape-arson. Roll credits.

Next episode is 10+ minutes of unfilterd satorika sex followed by lots of hugging and crying and a skip to the birthday scene cliffhanger.

The remaining 2 episodes are just sex. Nothing but sex. Not a single word of dialog that isn't just horny moans and screaming each others' names. We never get an answer to what happened, but this is the ultimate ending to Higurashi, the culimnation of everything. Thank you for watching..

>>	Anonymous Mon Sep 6 09:59:24 2021 No.36447347 >>36447337 The following, but the sex is between Satoko and Tomita

>>	Anonymous Mon Sep 6 10:04:58 2021 No.36447407 >>36447337 That's too ideal, I don't think it will be that but if it was, Sotsu would go from a 4/10 to a 9/10

>>	Anonymous Mon Sep 6 10:09:02 2021 No.36447443 File: 22 KB, 400x400, tegaki.png [View same] [iqdb] [saucenao] [google] >>36447097

>>	Anonymous Mon Sep 6 10:14:35 2021 No.36447487 >>36447347 No, between everyone. I distinctly remember a post where anon listed all the sex but I can't find it in warosu now. Which is sad, because it was a good post.

>>	Anonymous Mon Sep 6 10:18:20 2021 No.36447515 >>36447443 Based Cowchad Thanks

>>	Anonymous Mon Sep 6 10:18:58 2021 No.36447520 >>36447443 Cute baby cow.

>>	Anonymous Mon Sep 6 10:28:44 2021 No.36447573 Enje died a virgin

>>	Anonymous Mon Sep 6 10:34:07 2021 No.36447620 >>36447274 Is Higanbana a Higurashi OAV that I missed like Daybreak?

>>	Anonymous Mon Sep 6 10:43:18 2021 No.36447700 File: 1.65 MB, 1011x2978, 91113979_p0.jpg [View same] [iqdb] [saucenao] [google] >>36444488 Wait, this isn't right! Hanyuu was supposed to be SatoRika's child, not their babysitter.

>>	Anonymous Mon Sep 6 10:47:06 2021 No.36447726 Hanyuu has very little use. Utility is low. Overall performance is poor. There’s not much point in Hanyuu.

>>	Anonymous Mon Sep 6 10:48:05 2021 No.36447733 oregnant hanyuu

>>	Anonymous Mon Sep 6 10:48:13 2021 No.36447736 File: 546 KB, 2000x2667, E-lzbDRUcAcaHCQ.jpg [View same] [iqdb] [saucenao] [google] Reminder that we will never get winter Hinamizawa because of muh cicada season.

>>	Anonymous Mon Sep 6 10:51:08 2021 No.36447770 Hanyuu is onahole

>>	Anonymous Mon Sep 6 10:52:07 2021 No.36447778 what is hanyuu's special technique for the customers at angel mort?

>>	Anonymous Mon Sep 6 10:54:37 2021 No.36447792 >>36444478 Ohhh, witch Satoko is already starting to break down? That was fast, it's only been 2 episodes.

>>	Anonymous Mon Sep 6 10:58:05 2021 No.36447813 Hypnotized Enje but for what purpose?

>>	Anonymous Mon Sep 6 10:58:55 2021 No.36447817 File: 315 KB, 485x394, 1629647091103.png [View same] [iqdb] [saucenao] [google] >>36447778 just imagine a witch who's infinitely close to the seat of god serving dirty otaku customers in a whore suit at angel mort

>>	Anonymous Mon Sep 6 10:59:45 2021 No.36447823 >>36447817 They can’t see her though. As usual she is of no use.

>>	Anonymous Mon Sep 6 11:01:25 2021 No.36447837 Hypnotizing Enje into doing exercise

>>	Anonymous Mon Sep 6 11:01:54 2021 No.36447840 >>36447813 Her complaints where too loud when hooked up to the milking machine, this is much nicer.

>>	Anonymous Mon Sep 6 11:07:26 2021 No.36447896 >>36447823 why can't they see her clothes

>>	Anonymous Mon Sep 6 11:09:38 2021 No.36447915 File: 1.14 MB, 1756x1756, E-mM1JoVQAABe6a.jpg [View same] [iqdb] [saucenao] [google] Today's pointless Mei trivia of the day. Angel Satoko is the first one to have two different character activated skills, both obviously for Rika.

>>	Anonymous Mon Sep 6 11:13:54 2021 No.36447941 >>36447915 That's cool but being a gacha in japanese only ain't attractive to me

>>	Anonymous Mon Sep 6 11:16:52 2021 No.36447972 >>36447823 Hanyuu can become corporeal when she wants.

>>	Anonymous Mon Sep 6 11:25:25 2021 No.36448083 Enje working at Enjel Mort

>>	Anonymous Mon Sep 6 11:30:20 2021 No.36448138 >>36447941 Satoko isn't attractive to you? Based.

>>	Anonymous Mon Sep 6 11:33:29 2021 No.36448189 For me it's Rena > Shion > Mion > Satoko > Rika Describe my physical appearance

>>	Anonymous Mon Sep 6 11:35:11 2021 No.36448206 >>36447792 That's obviously a delighted expression.

>>	Anonymous Mon Sep 6 11:36:51 2021 No.36448220 >>36447972 This failure can’t do that. Especially not in Sotsu.

>>	Anonymous Mon Sep 6 11:37:05 2021 No.36448223 >>36448206 I've heard that autism can cause difficulties interpreting facial expressions, particularly microexpressions, but I didn't know it could extend to anime faces.

>>	Anonymous Mon Sep 6 11:38:18 2021 No.36448238 >>36448223 no i think he's right, eviltoko is looking at the disaster that akasaka caused and is laughing

>>	Anonymous Mon Sep 6 11:39:05 2021 No.36448243 >36448223 I don't care if you have autism or not, but in case you're incapable of reading that expression: it's a delighted one.

>>	Anonymous Mon Sep 6 11:40:24 2021 No.36448251 >>36448223 For me, this face screams to me that she just run out of toilet paper and is going to kill herself and fix that in the next loop.

>>	Anonymous Mon Sep 6 11:41:35 2021 No.36448263 I'm autistic and my favorite WTC is Lambdadelta

>>	Anonymous Mon Sep 6 11:42:53 2021 No.36448272 >>36448263 Hi, autistic and my favorite WTC is Lambdadelta, I'm Anonymous

>>	Anonymous Mon Sep 6 11:45:00 2021 No.36448288 >>36448223 It’s clear that this face is the one you make when you see that Kinzo is afraid to commit the same sin again.

>>	Anonymous Mon Sep 6 11:46:03 2021 No.36448297 kinzpのsin

>>	Anonymous Mon Sep 6 11:46:32 2021 No.36448302 >>36448251 >>36448288 For me, this is the face of a person who is breaking down under the guilt of her actions. But I'm autistic too so maybe I'm wrong.

>>	Anonymous Mon Sep 6 11:49:35 2021 No.36448337 >>36443598 What is this face expressing? Why is Rika squeezing an empty can?

>>	Anonymous Mon Sep 6 11:50:17 2021 No.36448350 >>36448206 >>36447792 Honestly for me (without context) it could be interpreted as both, stop being autistic.

>>	Anonymous Mon Sep 6 11:54:06 2021 No.36448400 >>36448337 you know

>>	Anonymous Mon Sep 6 11:55:26 2021 No.36448420 Even Kinzo became autistic when Beatrice died (or two Beatrices or however many)

>>	Anonymous Mon Sep 6 11:57:12 2021 No.36448443 >>36448337 Isn't she about to break down? Honestly I don't know, I'm autistic sadly.

>>	Anonymous Mon Sep 6 11:58:03 2021 No.36448454 >>36448350 It's interesting that literally every jap comment on the precuts sees mixed emotions, but shitposters in here try to deny it for some reason.

>>	Anonymous Mon Sep 6 11:58:31 2021 No.36448461 >>36448443 I mean, yeah, we know she loses the battle of endurance eventually, but she hadn't reached that point yet at that time.

>>	Anonymous Mon Sep 6 11:59:21 2021 No.36448471 >>36448454 There's a lot of obnoxious faggots here, and I don't like that

>>	Anonymous Mon Sep 6 12:00:02 2021 No.36448483 >>36448454 Sotsu is extremely deep so I think Satoko is thinking about how useless Hanyuu is while watching Akasaka explosion and also considering how autistic the viewers are.

Anonymous Mon Sep 6 12:02:35 2021 No.36448518

>>36448454
Considering the likely context, mixed emotions make no sense at all.

We just came from her burying her emotions and she'd back to killing her friends, something she did with a smile before.

That just comes off as wishful thinking of people who want to Satoko to start regretting stuff as soon as possible while disregarding how she has been written in this series.

>>	Anonymous Mon Sep 6 12:02:38 2021 No.36448519 I wonder if the femanon loves trolling

>>	Anonymous Mon Sep 6 12:03:54 2021 No.36448546 >>36448519 I’m 43

>>	Anonymous Mon Sep 6 12:04:32 2021 No.36448561 >>36446547 Release a Director's Cut edition with all the Endless Height crap cut out Gou/Sotsu is surprisingly good when you keep only the new parts and cut off Rika's dance, which you're seeing it for the 717371th time

>>	Anonymous Mon Sep 6 12:04:55 2021 No.36448569 >>36448518 Smart poster >>36448454 Filthy weeb

>>	Anonymous Mon Sep 6 12:05:48 2021 No.36448586 >>36448546 you said 33 last time

>>	Anonymous Mon Sep 6 12:05:53 2021 No.36448588 File: 1.94 MB, 640x526, korone.gif [View same] [iqdb] [saucenao] [google] >>36448272

Anonymous Mon Sep 6 12:06:12 2021 No.36448595
File: 156 KB, 1920x1080, Poor Satoko.jpg [View same] [iqdb] [saucenao] [google]

>>36448518
I was also surpirsed at how quickly the first one happened.

It's even funnier when we had this one moron who was crying that the episode 10 Satoko split came out of nowhere, when literally the entire season was building towards it.

>>	Anonymous Mon Sep 6 12:07:16 2021 No.36448621 >>36448561 Rika dance is the second best thing after Rika drinking tea

>>	Anonymous Mon Sep 6 12:08:17 2021 No.36448638 >>36448586 Lies.

>>	Anonymous Mon Sep 6 12:09:41 2021 No.36448669 >>36448483 I want to be deep in Satoko.

>>	Anonymous Mon Sep 6 12:10:05 2021 No.36448679 >>36448638 >>36369633

>>	Anonymous Mon Sep 6 12:13:09 2021 No.36448732 >>36444486 yes cum here

Anonymous Mon Sep 6 12:14:02 2021 No.36448746
File: 1.96 MB, 2552x3609, 92542551_p0.jpg [View same] [iqdb] [saucenao] [google]

>>36448561
Rika's dance honestly never bothered me before the last episode.
The part from 5:50 (end of Rika's inner thoughts) to 6:40 (cut to Hanyuu in sea of fragments) should be completely cut off. It serves no purpose.

Those 50 seconds could have been used on Satoko's shower scene.

>>	Anonymous Mon Sep 6 12:15:03 2021 No.36448756 >>36445746 Fucking Houjou cunts.

>>	Anonymous Mon Sep 6 12:16:05 2021 No.36448771 >>36446123 Bern and Lambda trying to learn backgammon

>>	Anonymous Mon Sep 6 12:17:23 2021 No.36448788 >>36448679 That’s clearly a different autistic anon who can’t identify facial expressions.

Anonymous Mon Sep 6 12:17:31 2021 No.36448789

>>36448746
>>36448621
>Rika's dance ho
nestly never bothered me before the last episode.
I mentioned Rika's dance because it was the first one that came to mind, probably due to last episode.
But that's just one of the many scenes that could've been cut off and it would make the anime better, even if you didn't replace it with anything and made the episode shorter.

I've read that the plan was to remake bait until the end of Watanagashi/Watadamashi. I can't imagine how someone could think this was a good idea.

>>	Anonymous Mon Sep 6 12:18:04 2021 No.36448797 >>36446430 >Do we need to know the specifics of how Satoko injected Kimiyoshi? Would love to know how Satoko injected Mion, for one.

>>	Anonymous Mon Sep 6 12:18:40 2021 No.36448805 >>36448595 The entirety of tatariakashi had her feel mixed emotions. They were followed by her witch eyes and evil smile sometimes, that's why people just ignored it as "oh she's just faking it all".

>>	Anonymous Mon Sep 6 12:19:48 2021 No.36448822 >>36446518 Anon we tried to figure out your riddle last time, but we don't have any clues I barely even noticed the link in the first pic, this time it's easier.

>>	Anonymous Mon Sep 6 12:20:52 2021 No.36448832 >>36448797 I thought she injected the can and that’s why we see the short scene of the can dropped on the ground. However the can should sort of leak or explode so maybe it’s just shitty writing.

>>	Anonymous Mon Sep 6 12:21:32 2021 No.36448845 File: 19 KB, 439x342, 1621662247705.jpg [View same] [iqdb] [saucenao] [google] >>36447055 whorie

>>	Anonymous Mon Sep 6 12:24:51 2021 No.36448882 >>36448845 So can people see her horns or what?

>>	Anonymous Mon Sep 6 12:25:19 2021 No.36448892 File: 59 KB, 512x325, 1620612855893.jpg [View same] [iqdb] [saucenao] [google] Time to enjoy Akasaka one last time.

>>	Anonymous Mon Sep 6 12:27:29 2021 No.36448920 >>36448892 Oh I'm sure Rika's gonna enjoy Akasaka alright

>>	Anonymous Mon Sep 6 12:27:52 2021 No.36448927 >>36448892 Rika is enjoying him for sure in the manga.

>>	Anonymous Mon Sep 6 12:28:25 2021 No.36448933 >>36447915 How can people have fun with Mei? No mechanics whatsoever

>>	Anonymous Mon Sep 6 12:28:50 2021 No.36448938 >>36448927 I like how Tomato did the brave thing and just had Akasaka rape Rika.

>>	Anonymous Mon Sep 6 12:32:34 2021 No.36449008 >>36448938 Well Satoko had Teppei, so Rika at least deserved to do it with a man she loves.

>>	Anonymous Mon Sep 6 12:33:52 2021 No.36449023 >>36448938 One has to wonder if she's willing to take his dick again after all of this is solved. Didn't she want it so bad?

Anonymous Mon Sep 6 12:36:11 2021 No.36449058
File: 194 KB, 398x390, hornybern.png [View same] [iqdb] [saucenao] [google]

>>36448746
>Those 50 seconds could have been used on Satoko's shower scene.
BD version:
Rika arrives at the Houjou residence a minute earlier, goes inside and hears Satoko happily humming in the shower. Rika decides to get naked and sneak into the shower with Satoko. Rika completely misses the bloody clothes because meep. Satoko quickly hugs and kisses Rika before she can see the blood on her. They make out in the hot shower until Rika is dizzy, then Satoko escorts euphoric Rika out, careful to not let her see any of the mess. The rest of the episode goes on like the TV version, except Satoko didn't get off and is even more horny around Keiichi. Basically drooling, grabbing more than his hand, dryhumping him instead of gently hugging, guiding his hand to her chest instead of just holding it in her hands, starting to undress at her house before getting the bat.

>>	Anonymous Mon Sep 6 12:40:04 2021 No.36449113 >>36449023 It's okay, manga Rika doesn't remember.

>>	Anonymous Mon Sep 6 12:40:13 2021 No.36449115 File: 1.52 MB, 1500x1500, Duel.png [View same] [iqdb] [saucenao] [google] How does this make you feel?

>>	Anonymous Mon Sep 6 12:40:57 2021 No.36449125 File: 171 KB, 1000x563, eua gokkun.jpg [View same] [iqdb] [saucenao] [google] >>36444493

>>	Anonymous Mon Sep 6 12:41:50 2021 No.36449141 >>36449125 What a messy eater. Not even Hanyuu was this dumb with creampuffs.

>>	Anonymous Mon Sep 6 12:41:54 2021 No.36449143 >>36449115 Yamitoko

Anonymous Mon Sep 6 12:42:15 2021 No.36449148
File: 676 KB, 900x1200, 313277 - Battler_Ushiromiya Lucifer Stakes_of_Purgatory Umineko_no_Naku_Koro_ni.jpg [View same] [iqdb] [saucenao] [google]

I woke up from an unpleasant dream earlier, and when I closed my eyes to try and sleep, I saw a witch and she dropped references to the bad dream, so I couldn't go back to sleep
I was thinking why not just grab the witch and start raping her sort of like this, but what if the witch was my mom or something, so I didn't do that
why did kinzo have to have a incest rape baby, he ruined everything

>>	Anonymous Mon Sep 6 12:43:46 2021 No.36449166 >>36449148 Why not make as many as you can to see what happens when they all become witches?

>>	Anonymous Mon Sep 6 12:44:57 2021 No.36449181 >>36449148 Delete the picture. Only Sakutato is allowed to sex Luci-nee.

Anonymous Mon Sep 6 12:46:43 2021 No.36449209
File: 146 KB, 1920x1080, 1615894507459.jpg [View same] [iqdb] [saucenao] [google]

>>36449115
Like Higurashi characters would be memorable one-arc Yu-Gi-Oh villains. Like Yugi and co have to duel everyone in Hinamizawa, in a tournament the three families organise with hilariously over the top horror vibes and ridiculous faces.

>>	Anonymous Mon Sep 6 12:46:46 2021 No.36449212 >>36449181 Who's Sakutato

>>	Anonymous Mon Sep 6 12:47:10 2021 No.36449217 File: 128 KB, 1066x1583, E-mij15VkAAoZXK.jpg [View same] [iqdb] [saucenao] [google] Left: Succubus Right: Onahole

Anonymous Mon Sep 6 12:47:45 2021 No.36449225

Ciconia is a sub-reality to the greater world revealed in Umineko, which means that everyone pushing simulation theory onto the other WTC works fails to understand that even if simulation theory is the answer to Ciconia, it only applies to the world of Ciconia, it is completely contained within the sub-reality (fragment, game board, etc.) that Ciconia takes place in.

>>	Anonymous Mon Sep 6 12:47:45 2021 No.36449226 >>36449212 Sakutaro's cool older brother

>>	Anonymous Mon Sep 6 12:48:00 2021 No.36449229 I did have a dream just a few days ago about Ryuukishi tweeting that witch satoko was like yami yugi

>>	Anonymous Mon Sep 6 12:48:05 2021 No.36449230 >>36449217 Their heads look weird but I can still fap to this.

>>	Anonymous Mon Sep 6 12:48:12 2021 No.36449231 >>36449212 It's a potato who looks like Satoshi.

>>	Anonymous Mon Sep 6 12:49:01 2021 No.36449242 >>36449217 What a cute pair of cumsluts

>>	Anonymous Mon Sep 6 12:49:24 2021 No.36449245 File: 3.68 MB, 1934x2605, 92007076_p0.png [View same] [iqdb] [saucenao] [google] >>36449230 As always with this artist. I think that's the first time he's drawn Rika?

>>	Anonymous Mon Sep 6 12:53:31 2021 No.36449295 File: 3.43 MB, 1748x2567, 91178746_p1.png [View same] [iqdb] [saucenao] [google] >>36449245 >first time he's drawn Rika? No, wait, there's this one.

>>	Anonymous Mon Sep 6 12:54:00 2021 No.36449304 File: 73 KB, 1000x563, cursed-higurashi-eua-freeza-dragon-ball-super.jpg [View same] [iqdb] [saucenao] [google] >>36449125

>>	Anonymous Mon Sep 6 12:54:34 2021 No.36449309 File: 23 KB, 400x400, 1629481518560.jpg [View same] [iqdb] [saucenao] [google] >>36448595 >when literally the entire season was building towards it. >2 scenes

>>	Anonymous Mon Sep 6 12:54:36 2021 No.36449311 >>36449304 at least try to fix the color balance, anon

>>	Anonymous Mon Sep 6 12:54:51 2021 No.36449315 >>36449304 NOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO

>>	Anonymous Mon Sep 6 12:55:10 2021 No.36449320 >>36449209 Her deck would definitely be around trap cards.

>>	Anonymous Mon Sep 6 12:55:16 2021 No.36449321 File: 100 KB, 235x277, hang_in_there.png [View same] [iqdb] [saucenao] [google] Okay I'm going to have to rearrange the order in which I explain this theory because it doesn't read very well as is.

>>	Anonymous Mon Sep 6 12:55:40 2021 No.36449326 >>36449320 Odiontoko

>>	Anonymous Mon Sep 6 12:57:27 2021 No.36449364 File: 78 KB, 484x600, Hanyuu fuck off.png [View same] [iqdb] [saucenao] [google] >>36449309 Dumb goat poster

>>	Anonymous Mon Sep 6 12:58:31 2021 No.36449380 File: 218 KB, 1280x720, 1603169515355.jpg [View same] [iqdb] [saucenao] [google] >>36449364 Not as dumb as anon saying THE ENTIRE SHOW FORESHADOWED THIS HUUUUR

>>	Anonymous Mon Sep 6 12:58:47 2021 No.36449383 >>36449321 Are you... are you trying to make a schizo theory more presentable? Cull the insanity out of it?

>>	Anonymous Mon Sep 6 12:59:40 2021 No.36449402 >>36449311 I honestly tried but I don't have the photoshop skills but if you know what buttons I need to press, I can try fixing it!

>>	Anonymous Mon Sep 6 13:00:46 2021 No.36449423 >>36449326 I need to ask Tegaki anon to draw next Odiontoko

Anonymous Mon Sep 6 13:01:23 2021 No.36449432

>>36449402
Paste it on a new layer then do some combination of editing the levels (ctrl+L in PS, the auto setting usually looks pretty good), or adding a color overlay (double click on the layer and select it from later styles, set it to low opacity and make the color gray or skin tone).

>>	Anonymous Mon Sep 6 13:01:59 2021 No.36449440 File: 476 KB, 1280x720, 1602545289896.png [View same] [iqdb] [saucenao] [google] >>36449423

>>	Anonymous Mon Sep 6 13:03:41 2021 No.36449457 Could you imagine if it was one of those "it was all a dream or simulation" endings?

>>	Anonymous Mon Sep 6 13:04:46 2021 No.36449471 >>36449380 Umineko foreshadowed this

>>	Anonymous Mon Sep 6 13:05:16 2021 No.36449476 File: 400 KB, 1000x563, cursed-higurashi-eua-freeza-dragon-ball-super-V2.png [View same] [iqdb] [saucenao] [google] >>36449432 ok how does this look

>>	Anonymous Mon Sep 6 13:05:26 2021 No.36449479 File: 280 KB, 1448x2048, E-IPRSIWQAE-xxi.jpg [View same] [iqdb] [saucenao] [google] >>36449115 Rena plays Ayyliens with Gol'gar Satoko normals Vega set 4 passes every opening

>>	Anonymous Mon Sep 6 13:05:50 2021 No.36449485 >>36449476 /dbs/ needs to get pancreatic cancer.

>>	Anonymous Mon Sep 6 13:05:53 2021 No.36449488 >>36449476 maginally better

>>	Anonymous Mon Sep 6 13:08:48 2021 No.36449518 >>36449476 It looks like dogshit, please don't bother

Anonymous Mon Sep 6 13:10:23 2021 No.36449531
File: 29 KB, 178x178, sip.png [View same] [iqdb] [saucenao] [google]

>>36449309
>>36449380
He's right, you know.
Entirety of Satoko's character development in Sotsu was building to it, she had doubts to begin with and went too far to be able to reconcile her actions. And Satoko takes most of the screentime, so it's not even the slightest exaggeration to say the entire season. Hell, it started before Sotsu when Gou episode 23 made it clear that Witch Satoko can't suppress her deepest human feelings that easily.

I'm sorry that you can't read the characters at all and have to complain about obvious developments when they happen. Though that's to be expected from one whose rhetoric ability is limited to inane greentext/capslock implications.

Anonymous Mon Sep 6 13:12:47 2021 No.36449566
File: 194 KB, 375x359, 1625938412615.png [View same] [iqdb] [saucenao] [google]

>>36449531
Like I said, 2 scenes aren't "the entirety" of anything, I don't think I stuttered.
Sorry that my delectable posting methods offend your sensitive festering wound.

>>	Anonymous Mon Sep 6 13:16:59 2021 No.36449621 >>36449531 S-sperg BTFO How will he recover from this logic.

>>	Anonymous Mon Sep 6 13:18:26 2021 No.36449630 >>36449566 Now you're being a pedant. His point was that it was amply foreshadowed, with several scenes and even a whole episode about it, not that the entire show was dedicated to it.

Anonymous Mon Sep 6 13:20:31 2021 No.36449645
File: 26 KB, 215x203, 1628670029191.png [View same] [iqdb] [saucenao] [google]

>>36449630
>so it's not even the slightest exaggeration to say the entire season
>when literally the entire season was building towards it.
>His point was that it was amply foreshadowed
>LITERALLY the entire season
I see.
Well, it IS ESL hours....

>>	Anonymous Mon Sep 6 13:21:45 2021 No.36449664 >>36449645 A scene about Satoko's inner conflict appeared in episode 1 of Sotsu, so he's right. Again, you're being a pedant and ignoring the heart of the argument. If you're thying to cosplay Bern you're doing a great job.

>>	Anonymous Mon Sep 6 13:23:42 2021 No.36449695 >>36449566 I don't even know what you mean with 2 scenes, tranny-obsessed shitposter-kun. Almost every scene of Satoko is part of the buildup. Literally the entire season.

Anonymous Mon Sep 6 13:30:07 2021 No.36449787

>>36449664
>A scene about Satoko's inner conflict appeared in episode 1 of Sotsu
This. How can people forget satoko looking mildly bored at Rena for 5 seconds in the beginning of Onidamashi before plunging her into despair? That was ample foreshadowing of her inner conflict, just like satoko not flexing her witch eyes every time she tells a lie. That was ample foreshadowing as well.

Anonymous Mon Sep 6 13:32:17 2021 No.36449819

>>36449664
>so he's right
>LITERALLY the entire season
No, "he" LITERALLY isn't.
Just accept the fact that you were wrong.

>>36449695
>I don't even know what you mean by "2 scenes"
That's a "you" problem. I meant that the "build up" was there for two scenes.
>ALMOST EVERY scene
>literally the entire season
Learn English, please.
And it was just 2 scenes of Satoko having slight doubts, dare I say "lol"? Because 2 scenes aren't LITERALLY the entire season.
I won't respond to your requests for attention any further. It's obvious that you are never letting this conversation stop without you having the last word, even if you can't make an argument besides "I-I don't get it". Amazing.
No wonder the threads got ruined like this when we have shitposters that spam entire threads with idiotic arguments, hyperbolic statements and imageflooding because we didn't like the op of the other thread, or something.
>>36449787
See, you just can't stop. Two short scenes don't make an entire season. I am going to wear this on a placat and go outside the Japanese embassy in Washington.

>>	Anonymous Mon Sep 6 13:32:56 2021 No.36449834 >>36449819 Oh it's you again.

>>	Anonymous Mon Sep 6 13:33:40 2021 No.36449851 >>36449834 Hello, hope you are in good health.

>>	Anonymous Mon Sep 6 13:34:11 2021 No.36449863 >>36449819 Why does japan have an embassy in washington?

>>	Anonymous Mon Sep 6 13:36:46 2021 No.36449914 File: 173 KB, 618x539, awesome.jpg [View same] [iqdb] [saucenao] [google] Wow, someone's literally going insane.

>>	Anonymous Mon Sep 6 13:37:14 2021 No.36449921 >>36449819 This butthurt burns my eyes.

>>	Anonymous Mon Sep 6 13:37:14 2021 No.36449922 File: 160 KB, 326x309, 1604806600313.png [View same] [iqdb] [saucenao] [google]

>>	Anonymous Mon Sep 6 13:38:29 2021 No.36449940 Will we see literal hell in Ciconia? I wonder how that is like...

>>	Anonymous Mon Sep 6 13:48:43 2021 No.36450095 >>36449914 All I see is stubs. The gates of my garden are closed to trash like that.

>>	Anonymous Mon Sep 6 13:54:02 2021 No.36450198 >>36450095 >All I see is stubs. I did tell you to never look between your legs again.

>>	Anonymous Mon Sep 6 13:59:12 2021 No.36450281 >>36450095 Stubs? Why dirty up the place when you can just disable them and deny their existence?

>>	Anonymous Mon Sep 6 14:03:12 2021 No.36450350 >>36450281 For the occasional false positives

>>	Anonymous Mon Sep 6 14:04:10 2021 No.36450364 I am just enjoying the fact that you have to manually hide posts.

>>	Anonymous Mon Sep 6 14:06:01 2021 No.36450393 >>36450364 Post manually hidden!

>>	Anonymous Mon Sep 6 14:06:50 2021 No.36450402 File: 228 KB, 640x480, enje.png [View same] [iqdb] [saucenao] [google] Bros, why is my Enje so bright? Enje is supposed to be a cool edgy character, not this bright faggotry.

>>	Anonymous Mon Sep 6 14:08:56 2021 No.36450423 File: 163 KB, 2000x1866, 1625179900637.jpg [View same] [iqdb] [saucenao] [google] POST HIDDEN

>>	Anonymous Mon Sep 6 14:09:27 2021 No.36450429 Cownge

>>	Anonymous Mon Sep 6 14:10:20 2021 No.36450434 File: 59 KB, 1000x563, 1614669266486.jpg [View same] [iqdb] [saucenao] [google] >>36450198

>>	Anonymous Mon Sep 6 14:11:45 2021 No.36450457 >>36450423 Fat resolution as expected of Ange

>>	Anonymous Mon Sep 6 14:11:57 2021 No.36450459 Satoko's inner conflict was foreshadowed all the way in Satokowashi-hen in Gou. Anyone who says otherwise literally can't read characters.

>>	Anonymous Mon Sep 6 14:12:13 2021 No.36450465 >>36450402 the ps3 version was really nice to her face and waist.

>>	Anonymous Mon Sep 6 14:14:50 2021 No.36450501 >>36450459 Everyone remembers the scene with Teppei. People's problem is that there were only two moments of regret in Sotsu regarding the rest of the cast.

Anonymous Mon Sep 6 14:14:57 2021 No.36450503
File: 147 KB, 1920x1080, 1605178487167.jpg [View same] [iqdb] [saucenao] [google]

>>36450434
Why did they have to make her so hot? She doens't even do anything. She just sits there and laughs, sometimes she dumps exposition, that's it.
Still the hottest character of the show. Why is so erotic? Why does she make my penis bigger?

>>	Anonymous Mon Sep 6 14:15:30 2021 No.36450516 >>36450503 Satoko is hotter than Eua.

>>	Anonymous Mon Sep 6 14:15:59 2021 No.36450525 >>36450516 I will murder you.

>>	Anonymous Mon Sep 6 14:16:17 2021 No.36450527 07th Expansion works are only appreciated by hag lovers and loli lovers and there is no in between

>>	Anonymous Mon Sep 6 14:16:45 2021 No.36450534 >>36450525 Why can't we live in peace? Me up here, and you down there, where you belong.

>>	Anonymous Mon Sep 6 14:17:37 2021 No.36450542 >>36450534 Ah, I see you have to make this about your ego. No. Eua is hotter. You are a pedo.

>>	Anonymous Mon Sep 6 14:17:47 2021 No.36450544 >>36450503 Featherine/ikuko is also the hottest winner In Umineko and she has no direct interaction with the events on the island. She just picks up a refugee and writes fanfiction for profit and to ruin Ange’ life.

>>	Anonymous Mon Sep 6 14:18:24 2021 No.36450556 >>36450542 It was a joke. I like Eua too. She's very cute.

>>	Anonymous Mon Sep 6 14:18:46 2021 No.36450561 >>36450544 Thank you for this detailed information about Featherine's character, dear anon. >>36450556 Ah, shit! H-haha.

>>	Anonymous Mon Sep 6 14:20:50 2021 No.36450590 >>36448595 That's me and I was saying it because it makes zero fucking sense for Satoko to forgive Rika because of what Teppei did. Also again, that screenshot is nothing, we know for a fact Satoko felt nothing for Rena.

>>	Anonymous Mon Sep 6 14:21:24 2021 No.36450595 >>36450561 It’s important to acknowledge winners

>>	Anonymous Mon Sep 6 14:22:25 2021 No.36450606 >>36450590 Obsessed

>>	Anonymous Mon Sep 6 14:22:43 2021 No.36450616 File: 3.57 MB, 1920x1080, 1625761051213.png [View same] [iqdb] [saucenao] [google] >>36450595 It's too bad that Gou had to be made in order for her to get more than like, 10 fanarts

>>	Anonymous Mon Sep 6 14:23:53 2021 No.36450627 >>36450616 That nose is bad.

>>	Anonymous Mon Sep 6 14:26:00 2021 No.36450647 >>36450616 Her console art gave her an ugly face, which probably played a bit role in her lack of art before Gou.

>>	Anonymous Mon Sep 6 14:28:43 2021 No.36450700 File: 3.13 MB, 1422x1078, 1601020456319.png [View same] [iqdb] [saucenao] [google] >>36450627 >>36450647

>>	Anonymous Mon Sep 6 14:30:58 2021 No.36450740 File: 341 KB, 1422x1078, 1613467526992.jpg [View same] [iqdb] [saucenao] [google] >>36450700 >>36450434

>>	Anonymous Mon Sep 6 14:31:19 2021 No.36450749 >>36450616 Eua =/= Featherine

>>	Anonymous Mon Sep 6 14:31:35 2021 No.36450757 File: 3.16 MB, 1422x1078, 1601020456319.png [View same] [iqdb] [saucenao] [google]

>>	Anonymous Mon Sep 6 14:32:34 2021 No.36450776 >>36450749 Proof?

>>	Anonymous Mon Sep 6 14:33:25 2021 No.36450790 File: 3.13 MB, 1422x1078, 1618395716702.png [View same] [iqdb] [saucenao] [google] >>36450757

>>	Anonymous Mon Sep 6 14:33:40 2021 No.36450794 >>36450776 The major differences are that Eua is wearing a miko outfit and has Satoko Syndrome (34 Syndrome?). Besides that it's really about the same.

>>	Anonymous Mon Sep 6 14:34:13 2021 No.36450806 File: 3.16 MB, 1422x1078, 1601020456319.png [View same] [iqdb] [saucenao] [google]

>>	Anonymous Mon Sep 6 14:36:18 2021 No.36450839 >>36450776 Hanyuu = Featherine and Hanyuu =/= Eua

>>	Anonymous Mon Sep 6 14:37:13 2021 No.36450848 >>36450839 >Hanyuu =/= Eua Proof?

>>	Anonymous Mon Sep 6 14:37:22 2021 No.36450852 File: 158 KB, 640x480, enje is fucking dead.png [View same] [iqdb] [saucenao] [google] I got Enje in the correct color. But at what cost?

>>	Anonymous Mon Sep 6 14:38:02 2021 No.36450859 >>36450852 Why are you ruining reality, anon?

>>	Anonymous Mon Sep 6 14:38:20 2021 No.36450864 >>36450848 She calls her a failure. Would she call herself a failure? Obviously not.

>>	Anonymous Mon Sep 6 14:39:04 2021 No.36450872 >>36450864 >Would she call herself a failure? If she ever self-reflected, yes.

>>	Anonymous Mon Sep 6 14:40:13 2021 No.36450892 File: 150 KB, 640x480, ENJE TOO DARK.png [View same] [iqdb] [saucenao] [google] WHAT THE FUCK I SWITCHED ENJE SPRITES AND NOW SHE'S TOO DARK WHY??????

>>	Anonymous Mon Sep 6 14:40:40 2021 No.36450895 >>36450892 Dange

>>	Anonymous Mon Sep 6 14:40:48 2021 No.36450899 >>36449217 fEAUtherine AUgustus Aurora

>>	Anonymous Mon Sep 6 14:41:02 2021 No.36450903 >>36450864 Besides the fact that the "her" you're speaking of isn't even Hanyuu, yes actually.

>>	Anonymous Mon Sep 6 14:41:21 2021 No.36450908 Euarrumatio

>>	Anonymous Mon Sep 6 14:42:11 2021 No.36450917 Eua's seiyou whispering sweet nothings in my ear

>>	Anonymous Mon Sep 6 14:44:48 2021 No.36450947 Eua's diet

>>	Anonymous Mon Sep 6 14:45:19 2021 No.36450953 >>36450864 A character who undergoes self improvement tends to look down on their past selves, that's a pretty common trait. Like how Tsumihoroboshi Keiichi thinks poorly of his Onikakushi self.

>>	Anonymous Mon Sep 6 14:45:40 2021 No.36450962 >>36450527 A good number of the lolis are also hags.

>>	Anonymous Mon Sep 6 14:46:59 2021 No.36450974 >>36446472 >>36446480 >>36446488 Oh I get it, since Hanyuu dies in this episode, they're gonna try make it extra emotional by showing her old scenes.

>>	Anonymous Mon Sep 6 14:48:00 2021 No.36450991 >>36450903 >>36450864 Note that the term used for lingering scent Hanyuu (残り香) is the same one WitchSatoko used to reference human Satoko.

>>	Anonymous Mon Sep 6 14:49:24 2021 No.36451017 >>36450947 Cum only.

>>	Anonymous Mon Sep 6 14:49:54 2021 No.36451025 >>36444488 did she watch people having sex?

>>	Anonymous Mon Sep 6 14:51:08 2021 No.36451039 >>36451017 Along with anon's semen, she drinks tea and Mountain Dew, and eats popcorn, Cheetos, etc.

>>	Anonymous Mon Sep 6 14:51:48 2021 No.36451050 >>36451039 all made out of my cum

>>	Anonymous Mon Sep 6 14:55:11 2021 No.36451096 >>36451039 So relatable.

>>	Anonymous Mon Sep 6 15:10:55 2021 No.36451336 File: 427 KB, 1000x967, 89887564_p4.jpg [View same] [iqdb] [saucenao] [google] >>36447817 I don't have to imagine when hanyuu makes me cum on a daily basis.

>>	Anonymous Mon Sep 6 15:13:06 2021 No.36451366 >>36449922 no one is gonna convince me R07 isn't closeted trans also >triple dubs checked

>>	Anonymous Mon Sep 6 15:14:00 2021 No.36451382 >>36451366 WTC is his closet.

>>	Anonymous Mon Sep 6 15:15:11 2021 No.36451405 phase 2?

>>	Anonymous Mon Sep 6 15:15:50 2021 No.36451415 >>36451405 phased out of existence.

>>	Anonymous Mon Sep 6 15:18:01 2021 No.36451448 File: 466 KB, 1181x751, 1630844229830.jpg [View same] [iqdb] [saucenao] [google]

>>	Anonymous Mon Sep 6 15:20:03 2021 No.36451477 >>36451448 rikute

>>	Anonymous Mon Sep 6 15:27:24 2021 No.36451594 File: 2.46 MB, 1422x1078, faceless_void.png [View same] [iqdb] [saucenao] [google] >>36450757

>>	Anonymous Mon Sep 6 15:41:23 2021 No.36451787 >>36450516 Thanks, Captain Obvious.

>>	Anonymous Mon Sep 6 15:44:19 2021 No.36451834 File: 540 KB, 1400x1400, 87295393_p0.jpg [View same] [iqdb] [saucenao] [google] >>36451448 This concept is the second best thing about Gou.

>>	Anonymous Mon Sep 6 15:45:21 2021 No.36451842 >>36451834 Satoko on top feels so right

>>	Anonymous Mon Sep 6 15:46:13 2021 No.36451856 File: 870 KB, 2894x4093, E-nEu6DVcAIqSBl.jpg [View same] [iqdb] [saucenao] [google] Nii-Nii! Let's play baseball!

>>	Anonymous Mon Sep 6 15:47:13 2021 No.36451869 File: 451 KB, 1389x982, 92466244_p0.jpg [View same] [iqdb] [saucenao] [google]

>>	Anonymous Mon Sep 6 15:48:31 2021 No.36451890 >>36451869 How come Rika gets to have TWO Satokowives and I have zero?

>>	Anonymous Mon Sep 6 15:48:53 2021 No.36451899 File: 365 KB, 1280x720, higurashisui_49_cs1w1_1280x720.jpg [View same] [iqdb] [saucenao] [google] >>36451842 you just want to be on top of and pin rika

>>	Anonymous Mon Sep 6 15:50:31 2021 No.36451925 >>36451899 I want Rika from every way and every position imaginable.

>>	Anonymous Mon Sep 6 15:55:38 2021 No.36452002 File: 1.71 MB, 8881x4992, 1625973725783.png [View same] [iqdb] [saucenao] [google] >>36451834 What's the first?

>>	Anonymous Mon Sep 6 15:57:56 2021 No.36452037 File: 330 KB, 800x800, E-nEgW-VgAM4JR5.jpg [View same] [iqdb] [saucenao] [google]

>>	Anonymous Mon Sep 6 16:00:15 2021 No.36452071 File: 176 KB, 1499x1627, E-m71GDVcAIDxRC.jpg [View same] [iqdb] [saucenao] [google] A silly Satoko Teppei story 1/6

>>	Anonymous Mon Sep 6 16:01:16 2021 No.36452084 File: 1.09 MB, 640x480, OUTPUTMOVIE.webm [View same] [iqdb] [saucenao] [google] Don't open this spoiler if you like Ushiromiya Enje

>>	Anonymous Mon Sep 6 16:01:31 2021 No.36452088 File: 301 KB, 1450x2048, E-m71GCUYAUXRMP.jpg [View same] [iqdb] [saucenao] [google] >>36452071

>>	Anonymous Mon Sep 6 16:01:52 2021 No.36452098 >>36452084 I don't like her so I will open it.

>>	Anonymous Mon Sep 6 16:01:54 2021 No.36452099 >>36452084 Everything is too bright. FIX IT

>>	Anonymous Mon Sep 6 16:02:17 2021 No.36452103 >>36452084 Holy based

>>	Anonymous Mon Sep 6 16:02:27 2021 No.36452106 File: 678 KB, 379x380, 1626281455510.gif [View same] [iqdb] [saucenao] [google] >>36452084

>>	Anonymous Mon Sep 6 16:02:34 2021 No.36452110 File: 394 KB, 1450x2048, E-m71GEUYAAGgm9.jpg [View same] [iqdb] [saucenao] [google] >>36452088

>>	Anonymous Mon Sep 6 16:03:28 2021 No.36452129 >>36452084 Jesus Christ Why would you create something like this?

>>	Anonymous Mon Sep 6 16:03:29 2021 No.36452130 >>36452084 okay but where's the other half of the animation???

>>	Anonymous Mon Sep 6 16:03:38 2021 No.36452137 File: 360 KB, 1450x2048, E-m78dEVcAArZF3.jpg [View same] [iqdb] [saucenao] [google] >>36452110

>>	Anonymous Mon Sep 6 16:04:35 2021 No.36452156 i want to bite and tear anges left nipple off

>>	Anonymous Mon Sep 6 16:04:41 2021 No.36452161 File: 302 KB, 1450x2048, E-m78dUVgAgna2I.jpg [View same] [iqdb] [saucenao] [google] >>36452137

>>	Anonymous Mon Sep 6 16:05:44 2021 No.36452180 File: 311 KB, 1450x2048, E-m78doVUAMIpcU.jpg [View same] [iqdb] [saucenao] [google] >>36452161

>>	Anonymous Mon Sep 6 16:06:18 2021 No.36452190 >>36452099 I tried my best. Please no bully. >>36452130 I ended it abruptly because I have no clue how to make the individual pieces of Enje disappear after entering Lambda's mouth.

>>	Anonymous Mon Sep 6 16:06:46 2021 No.36452205 File: 324 KB, 1450x2048, E-m8gtCVEAk5dlr.jpg [View same] [iqdb] [saucenao] [google] >>36452180 7/6 Whoops, it ws actually 9 pages. Hope I got them in correct order.

Anonymous Mon Sep 6 16:07:44 2021 No.36452217

>>36452190
I got no idea about video editing but you want a layer or whatever they call it that hides what you put over it, a boolean thingy in a rectangle starting to the right of lambda's mouth. or you can probably make the pieces go away after a certain duration.

>>	Anonymous Mon Sep 6 16:07:49 2021 No.36452220 File: 474 KB, 1450x2048, E-m8gtXVQAs525g.jpg [View same] [iqdb] [saucenao] [google] >>36452205

>>	Anonymous Mon Sep 6 16:08:52 2021 No.36452239 File: 380 KB, 1450x2048, E-m8gtrUYAQiSly.jpg [View same] [iqdb] [saucenao] [google] >>36452220 And of course the whole thing got reposted to pixiv, what a pointless dump this was. orz https://www.pixiv.net/en/artworks/92562844

>>	Anonymous Mon Sep 6 16:10:28 2021 No.36452265 >>36451890 You need to spend a century grooming your first Satoko until she develops the ideal balance between love and hatred.

>>	Anonymous Mon Sep 6 16:11:56 2021 No.36452290 File: 1.10 MB, 2055x1339, E-myC2lVkAAqKup.jpg [View same] [iqdb] [saucenao] [google]

>>	Anonymous Mon Sep 6 16:15:23 2021 No.36452335 File: 176 KB, 888x609, E-nDpfMVcAUhdJa.jpg [View same] [iqdb] [saucenao] [google]

>>	Anonymous Mon Sep 6 16:23:22 2021 No.36452440 >>36452161 >>36452180 what is this thrice damned mesugaki doing

>>	Anonymous Mon Sep 6 16:23:46 2021 No.36452451 File: 105 KB, 613x518, a cunning trick.jpg [View same] [iqdb] [saucenao] [google] >>36452440

>>	Anonymous Mon Sep 6 16:31:05 2021 No.36452550 Being enslaved by cunny...

>>	Anonymous Mon Sep 6 16:34:50 2021 No.36452599 File: 118 KB, 300x300, 1610766638798.png [View same] [iqdb] [saucenao] [google] >>36452550

Anonymous Mon Sep 6 16:42:48 2021 No.36452689

>>36452440
To quote Satoko on the second page -- My, don't you know what it means when a niece of /that age/ does this to her non-blood related uncle?
She was just going to bed without pajamas and inviting Teppei over. She won't catch a cold if her uncle warms her up!

She planned to seduce Teppei to create evidence of sexual abuse, but it didn't work. So she keeps attacking Teppei every night (apparently with niece x uncle porn) but Teppei just thinks her behavior is all his fault and wants to protect Satoko no matter what.
That is his sin atonement (tsumihoroboshi)

>>	Anonymous Mon Sep 6 16:42:56 2021 No.36452693 >>36452084 Why does her delusion now imply vore?

>>	Anonymous Mon Sep 6 16:47:13 2021 No.36452735 >>36452693 Lambda isn't part of her delusions

>>	Anonymous Mon Sep 6 16:49:05 2021 No.36452764 >>36452735 There is no real magic

>>	Anonymous Mon Sep 6 16:49:23 2021 No.36452770 >>36452764 For you

>>	Anonymous Mon Sep 6 16:49:49 2021 No.36452777 >>36452764 ngmi

>>	Anonymous Mon Sep 6 16:51:29 2021 No.36452793 >>36452770 >>36452777 Read the manga

>>	Anonymous Mon Sep 6 16:52:41 2021 No.36452806 >>36452793 changes nothing

>>	Anonymous Mon Sep 6 16:53:49 2021 No.36452822 >>36452735 Lambda is just a concept just like Bern

>>	Anonymous Mon Sep 6 16:57:10 2021 No.36452853 File: 828 KB, 1168x824, 676759.png [View same] [iqdb] [saucenao] [google] >>36452793 the mangas getting weird

Anonymous Mon Sep 6 16:57:52 2021 No.36452861
File: 427 KB, 467x896, file.png [View same] [iqdb] [saucenao] [google]

https://www.pixiv.net/en/artworks/92566005
onuma kuma got completely carried away with satozuri and made too much of it...

He's already posted like 30 pages on pixiv (way more behind fanbox paywall) and now he's going to make a CG set for DLsite release.

>>	Anonymous Mon Sep 6 17:01:12 2021 No.36452902 >>36452853 >this is canon according to mangatards I know they're mentally ill but this is just delusional.

>>	Anonymous Mon Sep 6 17:06:02 2021 No.36452948 >>36452853 Is Lion a male in this one?

>>	Anonymous Mon Sep 6 17:07:54 2021 No.36452965 >>36452084 based enje a shit

>>	Anonymous Mon Sep 6 17:08:29 2021 No.36452969 File: 880 KB, 1272x752, 75508.png [View same] [iqdb] [saucenao] [google] >>36452948 does it matter

>>	Anonymous Mon Sep 6 17:13:48 2021 No.36453027 File: 512 KB, 734x1117, enj_a21_komaru5.png [View same] [iqdb] [saucenao] [google] Degeneracy, filtered!

>>	Anonymous Mon Sep 6 17:14:29 2021 No.36453037 >>36453027 Enje's cute fingers.....

>>	Anonymous Mon Sep 6 17:14:39 2021 No.36453039 >>36453027 I filter all Ange images.

>>	Anonymous Mon Sep 6 17:16:09 2021 No.36453057 File: 178 KB, 804x538, 1616606977748.png [View same] [iqdb] [saucenao] [google] >>36453027 thats pretty funny coming from ange

>>	Anonymous Mon Sep 6 17:17:19 2021 No.36453075 Enje is literally me but with a vagina instead of a penis

>>	Anonymous Mon Sep 6 17:17:21 2021 No.36453076 >>36453057 Ange hates homosexuals

>>	Anonymous Mon Sep 6 17:22:08 2021 No.36453119 Enje impregnated by Mammon Enje is now a mother

>>	Anonymous Mon Sep 6 17:26:57 2021 No.36453175 File: 653 KB, 800x800, 1610654260670.jpg [View same] [iqdb] [saucenao] [google] Where are they going, /jp/?

>>	Anonymous Mon Sep 6 17:27:59 2021 No.36453186 Vier regularly fucks younger boys. Chloe empties Okonogi's balls every day. Gunhild masturbates in public.

>>	Anonymous Mon Sep 6 17:28:38 2021 No.36453194 >>36453186 Please post pictorial proof of these statements.

>>	Anonymous Mon Sep 6 17:28:40 2021 No.36453195 >>36453175 Uminegou

>>	Anonymous Mon Sep 6 17:29:05 2021 No.36453200 >>36453119 I want to be Enje and Mammon's infant child

>>	Anonymous Mon Sep 6 17:30:21 2021 No.36453217 Asmodeus pumping and dumping Jessica

>>	Anonymous Mon Sep 6 17:33:19 2021 No.36453252 All the Stakes should just get pregnant with each other

>>	Anonymous Mon Sep 6 17:35:08 2021 No.36453275 >>36453195 so to a better place

>>	Anonymous Mon Sep 6 17:36:55 2021 No.36453290 >>36453186 Even worse, Leah's eyes are drawn to every dick in her proximity. She simply can't restrain herself.

>>	Anonymous Mon Sep 6 17:36:58 2021 No.36453293 File: 313 KB, 536x501, file.png [View same] [iqdb] [saucenao] [google] Hanyuu's only use. https://twitter.com/oreizm/status/1434888035385036806

>>	Anonymous Mon Sep 6 17:38:44 2021 No.36453313 >>36453293 weird dick

>>	Anonymous Mon Sep 6 17:39:03 2021 No.36453318 terrible horny thread, I wish italianon would come back

>>	Anonymous Mon Sep 6 17:40:14 2021 No.36453334 File: 186 KB, 496x480, Bea_housina2.png [View same] [iqdb] [saucenao] [google] I'm only horny for the real Beatrice, not some witch fantasy. So pouty, so cute

>>	Anonymous Mon Sep 6 17:40:20 2021 No.36453336 >>36453318 The Enje vore animation is worth more than everything he created in his entire lifetime

>>	Anonymous Mon Sep 6 17:42:32 2021 No.36453356 >>36453334 Gross.

>>	Anonymous Mon Sep 6 17:49:47 2021 No.36453431 >>36449058 The fact that this won't happen proves that there is no justice in the world.

Anonymous Mon Sep 6 17:50:01 2021 No.36453432 [DELETED]

File: 91 KB, 343x440, Bernkastel_cringe.png [View same] [iqdb] [saucenao] [google]

>I want to have sex. sex sex sex.
>>36453217
>>36453252
>futa asmodesu uwu
>preggers jessica www
>preggers stakes owo
>>36453293
hanyuu facial, I'm so *horny* I have to post literal porn
GO TO /h/ FUCKING NIGGERs
>36453336
>t-the enje vore animation is *cums into own hand and drinks it* b-better than everything h-he ... *cums again* ever created i-in his entire lifetime *smugface*

Have sex you literal incels, this isn't a blue board for no reason.
Nobody gives a shit about your weird fetishes and repressed homosexuality.

>>	Anonymous Mon Sep 6 17:54:16 2021 No.36453479 File: 163 KB, 1600x1238, bern feet.jpg [View same] [iqdb] [saucenao] [google] >>36453432

>>	Anonymous Mon Sep 6 18:00:31 2021 No.36453547 Hello is this the Lambdadelta appreciation general?

>>	Anonymous Mon Sep 6 18:01:23 2021 No.36453558 File: 421 KB, 720x376, satoko lambda9.png [View same] [iqdb] [saucenao] [google] >>36453547 In a way, yes.

>>	Anonymous Mon Sep 6 18:02:45 2021 No.36453568 >>36453547 no, we dont like lady reddit

>>	Anonymous Mon Sep 6 18:03:06 2021 No.36453574 File: 1.28 MB, 1920x1080, trust.jpg [View same] [iqdb] [saucenao] [google] >>36453547 We all like Lambdadelta here.

>>	Anonymous Mon Sep 6 18:03:10 2021 No.36453575 >>36452161 >>36452180 This shit is just outright wrong

>>	Anonymous Mon Sep 6 18:04:59 2021 No.36453598 File: 461 KB, 586x962, Sebah.png [View same] [iqdb] [saucenao] [google] >>36453547 no, this is fate general

>>	Anonymous Mon Sep 6 18:07:20 2021 No.36453632 >>36453598 I always wondered, why did the autistics of the 90s and 00s absolutely dominate what we know now? 07th, Type Moon, ZUN, etc etc Were they just in the right place at the right time? Did they all talk to each other?

>>	Anonymous Mon Sep 6 18:07:31 2021 No.36453635 There are no attractive female characters in Fate/Stay Night. How did Nasu screw up so badly after Tsukihime?

>>	Anonymous Mon Sep 6 18:08:44 2021 No.36453649 File: 748 KB, 1440x454, king arthur.png [View same] [iqdb] [saucenao] [google] >>36453632 They were just good at what they did and gave the people what they longed for, simple as.

>>	Anonymous Mon Sep 6 18:09:27 2021 No.36453664 >>36453649 wtf is this writing

>>	Anonymous Mon Sep 6 18:10:02 2021 No.36453671 >>36453664 nasu the master

>>	Anonymous Mon Sep 6 18:10:48 2021 No.36453681 >>36453356 You take that back. Kuwadorian Beatrice is real, cute, and half-Italian

>>	Anonymous Mon Sep 6 18:11:16 2021 No.36453689 >>36453635 Rider's pretty hot

>>	Anonymous Mon Sep 6 18:12:20 2021 No.36453705 >>36453575 Why only those two pages, anon? All the other pages are pretty much the same gag. Satoko trying to get Teppei to take baths with her, etc.

>>	Anonymous Mon Sep 6 18:12:24 2021 No.36453709 File: 661 KB, 2894x4093, 1629499478098.jpg [View same] [iqdb] [saucenao] [google] >>36453432 ooo the bernfag is extra angry today

>>	Anonymous Mon Sep 6 18:12:53 2021 No.36453716 >>36453705 I just judge with my eyes

>>	Anonymous Mon Sep 6 18:14:08 2021 No.36453732 >>36453716 Do you think people read with their noses or something

>>	Anonymous Mon Sep 6 18:14:29 2021 No.36453735 >>36453732 duh

>>	Anonymous Mon Sep 6 18:14:39 2021 No.36453736 >>36453709 It's *****

>>	Anonymous Mon Sep 6 18:15:50 2021 No.36453757 >>36453705 satok is undressed there obviously

>>	Anonymous Mon Sep 6 18:17:32 2021 No.36453780 File: 354 KB, 800x600, HEY.png [View same] [iqdb] [saucenao] [google] >SATOKO LAMDA SATOKO RAIKA SATOKO Yeah this thread reeks of cringe. Time to fix that with some BADASS ACHA kino. https://www.youtube.com/watch?v=hXB53OyTsPM

>>	Anonymous Mon Sep 6 18:18:36 2021 No.36453798 >>36453736 seiba?

>>	Anonymous Mon Sep 6 18:19:00 2021 No.36453800 File: 1.18 MB, 388x272, 1626864241662.gif [View same] [iqdb] [saucenao] [google] >>36453780 Couldn't think of anyone relevant to the thread?

>>	Anonymous Mon Sep 6 18:19:24 2021 No.36453805 Nasu has better male characters Ryu07 has better female characters

>>	Anonymous Mon Sep 6 18:21:06 2021 No.36453831 >>36453805 Wrong and wrong, did you mix up their names or something?

>>	Anonymous Mon Sep 6 18:22:04 2021 No.36453843 >>36453805 I agree.

>>	Anonymous Mon Sep 6 18:22:32 2021 No.36453849 >>36453709 Couldn't think of a way to refute his points, huh?

>>	Anonymous Mon Sep 6 18:22:37 2021 No.36453851 >>36453800 Ooishi, Irie and Battler are the only characters I genuinely like. Battler is the least one though because he's basically a different person after ep 5

>>	Anonymous Mon Sep 6 18:22:47 2021 No.36453853 >>36453831 Nasu has Tohno Shiki Ryu07 has Lambdadelta That alone is enough to make a verdict

>>	Anonymous Mon Sep 6 18:23:43 2021 No.36453862 >>36453853 everything not fate doesn't count

>>	Anonymous Mon Sep 6 18:23:50 2021 No.36453865 File: 473 KB, 2500x2524, best_girl.jpg [View same] [iqdb] [saucenao] [google] >>36453805 Nope, Nasu is better in both.

>>	Anonymous Mon Sep 6 18:25:12 2021 No.36453880 >>36453862 Well I guess I shouldn't count Umineko either if we're ignoring their best works

>>	Anonymous Mon Sep 6 18:26:06 2021 No.36453886 Ryukishi has superior characters and art Nasu has superior writing and plot

>>	Anonymous Mon Sep 6 18:26:49 2021 No.36453893 >>36453865 Even Sacchin is going to have a route soon, and Illya still doesn't. Isn't it sad, Illya?

>>	Anonymous Mon Sep 6 18:26:52 2021 No.36453895 File: 56 KB, 590x590, 1628352791708.jpg [View same] [iqdb] [saucenao] [google] >ryukishi girls are better >nooo nasu girls are better ENTER

>>	Anonymous Mon Sep 6 18:26:58 2021 No.36453897 >>36453886 >Ryukishi has superior art lmao

>>	Anonymous Mon Sep 6 18:28:49 2021 No.36453917 File: 218 KB, 363x480, re_waraib1.png [View same] [iqdb] [saucenao] [google] >>36453897 Even at Takeuchi's best, he's no match for this.

>>	Anonymous Mon Sep 6 18:29:52 2021 No.36453925 File: 1.90 MB, 4070x5713, 4cc84a42865d375c6f04a243eb472176-downscaled.jpg [View same] [iqdb] [saucenao] [google] >>36453893 Illya doesn't need a route, everyone already loves her!

>>	Anonymous Mon Sep 6 18:32:50 2021 No.36453956 >>36453917 woah... the SOVL is too much...

>>	Anonymous Mon Sep 6 18:33:24 2021 No.36453962 File: 116 KB, 971x519, How the fuck should I know???.jpg [View same] [iqdb] [saucenao] [google] >>36453897 Far superior, indeed. His art elevates his writing to a new level.

>>	Anonymous Mon Sep 6 18:36:35 2021 No.36453990 >>36453962 People are obsessed with Satoko when she looks like THAT

>>	Anonymous Mon Sep 6 18:41:02 2021 No.36454027 That's it. Absolute lowest this general can get Worst thread ever. I'm shifting realities and moving to Rokenjima in 86.

>>	Anonymous Mon Sep 6 18:41:03 2021 No.36454028 >>36447813 so she can start a diet

>>	Anonymous Mon Sep 6 18:42:34 2021 No.36454042 >>36453895 I don't know who this is..

>>	Anonymous Mon Sep 6 18:43:10 2021 No.36454047 File: 133 KB, 370x480, sa_waraia1.png [View same] [iqdb] [saucenao] [google] >>36453990 That's right!

>>	Anonymous Mon Sep 6 18:43:51 2021 No.36454059 >>36453962 It's actually difficult to assess what might be a finger on those boxing glove hamfists,

>>	Anonymous Mon Sep 6 18:45:10 2021 No.36454068 >>36452084 holy kek fuck you ange

>>	Anonymous Mon Sep 6 18:46:18 2021 No.36454077 >>36454047 I see two reasons to obsess over Satoko.

>>	Anonymous Mon Sep 6 18:46:51 2021 No.36454083 File: 37 KB, 236x233, 2134645.png [View same] [iqdb] [saucenao] [google] >>36454068 post hidden!

>>	Anonymous Mon Sep 6 18:47:21 2021 No.36454088 File: 204 KB, 256x512, yuuka.png [View same] [iqdb] [saucenao] [google] More SOVL than the Higus, stronger than the witches and cuter than Satoko fifty times over. Ryukishi will never ever be able to create such a perfect character.

>>	Anonymous Mon Sep 6 18:48:40 2021 No.36454101 File: 160 KB, 379x480, sa_haua1.png [View same] [iqdb] [saucenao] [google] >>36454077 You want to see more?

>>	Anonymous Mon Sep 6 18:48:46 2021 No.36454103 >>36454077 1. Her cute smile! 2. Satoko!!!

>>	Anonymous Mon Sep 6 18:49:32 2021 No.36454112 >>36454047 I despise Satoko!

>>	Anonymous Mon Sep 6 18:50:50 2021 No.36454121 >>36454088 Yuuka can't even defeat a dumb doll.

>>	Anonymous Mon Sep 6 18:50:54 2021 No.36454125 >>36454112 Same.

>>	Anonymous Mon Sep 6 18:54:33 2021 No.36454157 >>36454101 Yes.

>>	Anonymous Mon Sep 6 18:56:06 2021 No.36454173 File: 141 KB, 258x480, sa_yareyarea2.png [View same] [iqdb] [saucenao] [google] >>36454157 ...

>>	Anonymous Mon Sep 6 18:57:33 2021 No.36454186 File: 87 KB, 184x174, 1614262028290.png [View same] [iqdb] [saucenao] [google] i came really hard and it still feels good down there 15 minutes later

>>	Anonymous Mon Sep 6 18:59:08 2021 No.36454205 File: 109 KB, 478x480, Kin_nakua1.png [View same] [iqdb] [saucenao] [google] >>36454173

>>	Anonymous Mon Sep 6 18:59:10 2021 No.36454208 >>36454186 Quality post.

>>	Anonymous Mon Sep 6 19:01:37 2021 No.36454237 >>36454186 At least someone's having fun and pleasure

>>	Anonymous Mon Sep 6 19:02:39 2021 No.36454244 >>36454186 I'd like an Ushiromiya aunt to take personal ownership of my dick so I don't masturbate too much.

Anonymous Mon Sep 6 19:03:38 2021 No.36454257

>>36454088
>>36453962
The only reason you folks don't dismiss this stuff as deviantart-tier is because it's attached to things you love and because of its amateurish nature that instantly makes your brain perceive them as quaint and "soulful", same reason humans are conditioned to root for the underdog in a movie.

>>	Anonymous Mon Sep 6 19:04:08 2021 No.36454262 >>36454244 but it's yasu

>>	Anonymous Mon Sep 6 19:08:33 2021 No.36454293 File: 325 KB, 629x904, 1630259713101.png [View same] [iqdb] [saucenao] [google] うーん，javascript がコケているわけではないのか？ ... ウミネコ(Umineko) UM-SH-01 耐寒-25度本格マミー型ダウンシュラフ寝袋クラウドライトス

>>	Anonymous Mon Sep 6 19:10:14 2021 No.36454304 >>36454257 Ryukishi is actually a very good chibi artist with quite unique and pleasant style. Especially his Higurashi sprites and older drawings were great. Can't think of anything positive to say about ZUN.

>>	Anonymous Mon Sep 6 19:12:17 2021 No.36454316 File: 165 KB, 662x1024, E-n9-4IVkAE7urw.jpg [View same] [iqdb] [saucenao] [google]

>>	Anonymous Mon Sep 6 19:12:18 2021 No.36454318 >>36454088 Hey it's Hikage! But why is she smiling?

>>	Anonymous Mon Sep 6 19:15:08 2021 No.36454336 >>36454186 Why do the steam sprites ooze so much soul? I could never get warm with the ps3 art or the OG jank sprites.

>>	Anonymous Mon Sep 6 19:19:36 2021 No.36454368 File: 133 KB, 775x873, 45645.jpg [View same] [iqdb] [saucenao] [google] >>36454336 I know, right. They're very spirited and I don't know why people don't like them.

>>	Anonymous Mon Sep 6 19:23:33 2021 No.36454402 >>36454368 contrarianism and nostalgia, that's it.

Anonymous Mon Sep 6 19:23:43 2021 No.36454404

>>36454368
I really don't like the sprites for some of the adult characters and Rena. Rena looks like a creepy doll on Steam sprites. Mion has a forehead that's bigger than Ooishi. Tomitake looks weird no matter the sprite, but this version, along with Takano's, makes the game really seem like a weird eroge.

>>	Anonymous Mon Sep 6 19:25:08 2021 No.36454414 >>36454368 >>36454336 They're not my favourite set but I find sprite purism pretty tedious so good for you if you like them anons.

>>	Anonymous Mon Sep 6 19:26:17 2021 No.36454426 i like both but pachinko sprites kinda suck, like what the fuck is up with hanyuu, she's so round, she looks like a fuckin alien

>>	Anonymous Mon Sep 6 19:26:28 2021 No.36454428 >>36449621 I'm going to crush your head like a watermelon. You P*ssed me off...

>>	Anonymous Mon Sep 6 19:26:57 2021 No.36454436 File: 98 KB, 1920x1080, 20210102103745_1.jpg [View same] [iqdb] [saucenao] [google] >>36454404 >Rena looks like a creepy doll on Steam sprites. Well, she is creepy.

>>	Anonymous Mon Sep 6 19:27:19 2021 No.36454442 File: 92 KB, 235x277, send help.png [View same] [iqdb] [saucenao] [google] >>36454316 We could have had this. But instead Ryuukishi chose to forget that Shion and Satoshi exist.

>>	Anonymous Mon Sep 6 19:27:29 2021 No.36454444 >>36453318 Me too...

>>	Anonymous Mon Sep 6 19:27:50 2021 No.36454449 >>36454428 S-Sperg bros. We s-stutter a lot. Maybe we lost..... >I-in before Sperg daily shitpost.

>>	Anonymous Mon Sep 6 19:28:38 2021 No.36454456 >>36454449 It's because it's so cold here in this loveless place...

>>	Anonymous Mon Sep 6 19:28:51 2021 No.36454459 File: 172 KB, 275x480, re_higurasi_defa1.png [View same] [iqdb] [saucenao] [google] >>36454436 Yeah, but I find -all- of her steam sprites creepy. Whereas I only find this one sort of creepy if not funny.

>>	Anonymous Mon Sep 6 19:29:46 2021 No.36454469 >>36453336 >DUDE LMAO VORE XD Guess how I know you have no chin? Stop jerking off and go touch grass, It's labor day

>>	Anonymous Mon Sep 6 19:29:52 2021 No.36454470 File: 31 KB, 400x297, 16748934543873465348943.jpg [View same] [iqdb] [saucenao] [google] At episode 2 of Umineko and it took me almost 10 hours to read ep1. How long is it? Am I just a slow reader...?

>>	Anonymous Mon Sep 6 19:30:47 2021 No.36454475 >>36453432 Based, Just fucking based. J/a/nnies are literally having a mental breakdown right now from your post!

>>	Anonymous Mon Sep 6 19:30:52 2021 No.36454478 Eua is probably a lesbian

>>	Anonymous Mon Sep 6 19:31:02 2021 No.36454480 >>36454470 That's not too unusual of a playtime I don't think. They're mostly between 8-12 hours.

>>	Anonymous Mon Sep 6 19:31:07 2021 No.36454481 >>36453336 Can you post it?

>>	Anonymous Mon Sep 6 19:31:13 2021 No.36454483 File: 137 KB, 1403x992, 07th wtclength.jpg [View same] [iqdb] [saucenao] [google] >>36454470

>>	Anonymous Mon Sep 6 19:31:37 2021 No.36454487 >>36454470 Speed readers get to 80 or 90 hours. You're about to enter one of the most boring ass fucking episodes of Umineko, and they're gonna get longer than that.

>>	Anonymous Mon Sep 6 19:31:51 2021 No.36454489 >>36453780 KINO!!!

>>	Anonymous Mon Sep 6 19:31:55 2021 No.36454493 >>36454470 That's normal, they are all around 10 hours average. If you listen to every voice line or spend a ton of time trying to solve the locked rooms it's more like 12 hours average.

>>	Anonymous Mon Sep 6 19:32:11 2021 No.36454494 >>36454481 Scroll up. It got many replies.

>>	Anonymous Mon Sep 6 19:32:39 2021 No.36454499 >>36454487 None of the episodes of Umineko are boring.

>>	Anonymous Mon Sep 6 19:32:42 2021 No.36454500 File: 109 KB, 288x438, 1515342563246.jpg [View same] [iqdb] [saucenao] [google] >>36454483

>>	Anonymous Mon Sep 6 19:32:51 2021 No.36454503 >>36454470 I wish it were longer.

>>	Anonymous Mon Sep 6 19:32:52 2021 No.36454504 >>36454487 At least it won't be as boring as episode 7.

>>	Anonymous Mon Sep 6 19:33:01 2021 No.36454505 File: 181 KB, 640x480, re_se_hi_b1.png [View same] [iqdb] [saucenao] [google] >>36454436 I mean, this look is perfect for a horror novel like higurashi. She just looks funny in the OG set.

>>	Anonymous Mon Sep 6 19:33:15 2021 No.36454506 >>36454499 The Shannon romance arc is terribly boring but also extremely important to the plot and themes later on.

>>	Anonymous Mon Sep 6 19:33:32 2021 No.36454509 >>36454499 EP2 is an absolute slog, specially on a reread. It killed my momentum completely to the point I put it off for 5 months.

>>	Anonymous Mon Sep 6 19:33:34 2021 No.36454510 >>36454494 kek, you were right, it's a masterpiece

>>	Anonymous Mon Sep 6 19:33:40 2021 No.36454511 >>36454442 What are you doing here little /a/tard? did you get lost when clicking /a/?

>>	Anonymous Mon Sep 6 19:34:41 2021 No.36454522 >>36454510 KEK Tis truly was!!!! Are you also trans btw!!?

>>	Anonymous Mon Sep 6 19:34:54 2021 No.36454524 >>36454506 >>36454509 It introduces interesting themes like the idea of love as the single element of the world and has some very touching scenes including the first mention of the thematic motto.

>>	Anonymous Mon Sep 6 19:35:31 2021 No.36454529 File: 191 KB, 1000x1000, E-nqVPZVEAEGMeA.jpg [View same] [iqdb] [saucenao] [google]

>>	Anonymous Mon Sep 6 19:36:02 2021 No.36454534 >>36454529 This but the opposite way

>>	Anonymous Mon Sep 6 19:36:27 2021 No.36454539 File: 1.32 MB, 1269x714, 1614277236861.png [View same] [iqdb] [saucenao] [google] It's that time again. Enjoy your spergfest. Euro hours are best hours. Until tomorrow.

>>	Anonymous Mon Sep 6 19:36:44 2021 No.36454545 >>36454534 That's just old Higurashi. The tables have turned, now.

>>	Anonymous Mon Sep 6 19:38:01 2021 No.36454558 File: 151 KB, 1920x1080, 20210102155244_1.jpg [View same] [iqdb] [saucenao] [google] >>36454459 That shit isn't intimidating in the slightest, though.

>>	Anonymous Mon Sep 6 19:38:09 2021 No.36454559 >>36454539 Sadly I still won't be here :( since you know, It's labor day. But don't worry I'll still post occasionally ;P

>>	Anonymous Mon Sep 6 19:38:10 2021 No.36454560 >>36454529 I hate when satoko does this to me...

>>	Anonymous Mon Sep 6 19:39:16 2021 No.36454571 >>36454558 Man, just looking at this gives me the chills. Steam sprites truly are the best if you're going for the horror atmosphere.

>>	Anonymous Mon Sep 6 19:39:48 2021 No.36454579 File: 192 KB, 496x480, beato.png [View same] [iqdb] [saucenao] [google] >>36454522 Yes, ty for noticing uwu

>>	Anonymous Mon Sep 6 19:41:16 2021 No.36454596 >>36454579 Beatrice isn't trans she's a biologicaly woman

>>	Anonymous Mon Sep 6 19:42:22 2021 No.36454605 File: 315 KB, 500x742, Italianon_dumb.png [View same] [iqdb] [saucenao] [google] >>36454596 Which Beatrice?

>>	Anonymous Mon Sep 6 19:44:04 2021 No.36454625 >>36454605 >People in 2021 STILL believe in the non-canon manga Goats everyone

>>	Anonymous Mon Sep 6 19:44:10 2021 No.36454626 >>36454558 Her head is like a giant egg supported on a tiny neck.

>>	Anonymous Mon Sep 6 19:45:11 2021 No.36454631 File: 190 KB, 400x400, 4ad83846488d2e9a2455d929a1487e25.png [View same] [iqdb] [saucenao] [google] >>36454625 Spergs in any era still not believing in the golden truth. Spergs everyone.

>>	Anonymous Mon Sep 6 19:46:34 2021 No.36454643 >>36454631 Just stfu man, I just watched train to busan and am not in the mood for this shit.

>>	Anonymous Mon Sep 6 19:46:52 2021 No.36454647 File: 253 KB, 1920x1080, 20210101224100_1.jpg [View same] [iqdb] [saucenao] [google] >>36454571 Yeah. It legit spooked me a little when her eyes first went funny. I suppose people with the original sprites must have had a pretty different experience.

Anonymous Mon Sep 6 19:47:56 2021 No.36454651 [SPOILER]

File: 264 KB, 1500x1500, smuggerdlanor[sound=files.catbox.moe%2Fqcknd4.mp3].png [View same] [iqdb] [saucenao] [google]

>>36454631
>n-no the manga HAS to be canon! Why? because...BECAUSE I SAID SO OKAY!
>Who cares if Ryukishi has lied in interviews before and that I'm a loveless goat who couldn't find the truth of umineko within the VN. I voted joe biden and I love abortions
Uh Goat-kun I think your getting carried away

>>	Anonymous Mon Sep 6 19:49:32 2021 No.36454662 File: 58 KB, 600x600, 7dfaaa7cd521c2ea16ee0610fd3f3106e05d74e6.jpg [View same] [iqdb] [saucenao] [google] >>36454643 Worthless shitposter.

>>	Anonymous Mon Sep 6 19:50:36 2021 No.36454670 >>36454643 Isn't that the one with all the scary zombies!...

>>	Anonymous Mon Sep 6 19:50:50 2021 No.36454675 >>36454605 Doesn't necessarily have to mean a boy, yada yada, you know how the usual talk goes. Just let people think Yasu's a woman if they want, it's left vague on purpose.

>>	Anonymous Mon Sep 6 19:50:54 2021 No.36454676 >>36454651 Holy shit, I just got to reply to this bait! It's just so anger inducing! I'm so furious!

Anonymous Mon Sep 6 19:50:58 2021 No.36454679
File: 136 KB, 237x441, RenaOG_a_(3).png [View same] [iqdb] [saucenao] [google]

>>36454647
I'm mixed on the OG sprites, but the simple childishness of their expressions made Rena's angry face stand out compared to her normal appearance and it freaked me out somewhat.

Anonymous Mon Sep 6 19:51:10 2021 No.36454682

>>36454647
>OGfans have funny meme sprites
>ps3fags lack photorealistic backgrounds
I'm really glad that I stumbled upon higurashi by accident last year on steam and not through the 07th mod advertisers. It literally combines the best of both worlds and comes with trophies and trading cards.

>>	Anonymous Mon Sep 6 19:51:55 2021 No.36454689 >>36454675 I'm just impressed at Nanjo's skills on a remote island several decades ago.

Anonymous Mon Sep 6 19:53:20 2021 No.36454704

>>36454676
>i-if i'm being ironic maybe I can pass my pure rage off as irony...
Come here little /a/-tard, Get ready to fly! Weeeeee! Woosh! Ahhhh get down enemy planes! Mayday Mayday we're going down Blomsh! Hahahaha That was fun! Now get inside and finish your homework you have school tomorrow!

>>	Anonymous Mon Sep 6 19:53:53 2021 No.36454706 File: 367 KB, 1668x673, 1623865867149.jpg [View same] [iqdb] [saucenao] [google] >>36454651 Have you even read it? It's very good. Check out this CANON manga image.

>>	Anonymous Mon Sep 6 19:54:18 2021 No.36454712 File: 966 KB, 750x920, file.png [View same] [iqdb] [saucenao] [google] >>36454704 >Blomsh

>>	Anonymous Mon Sep 6 19:54:27 2021 No.36454716 >>36454675 Pfthahahaha.

>>	Anonymous Mon Sep 6 19:55:29 2021 No.36454722 File: 227 KB, 346x428, 235235235.png [View same] [iqdb] [saucenao] [google] >>36454704 Never fear, Sperg is here! I'm sorry your Italian husband left you. He was impressive compared to you.

>>	Anonymous Mon Sep 6 19:55:30 2021 No.36454723 >>36454706 I've never read the manga or the animes (besides gou and sotsu). Only the Vn is of value! but wtf is lion doing in the manga! is she tasting soup?

>>	Anonymous Mon Sep 6 19:56:33 2021 No.36454733 >>36454712 I really really love that image anon :)

>>	Anonymous Mon Sep 6 19:57:28 2021 No.36454740 File: 90 KB, 305x183, IMG_1500.png [View same] [iqdb] [saucenao] [google] >>36454704 >blomsh as expected of a quality poster

Anonymous Mon Sep 6 19:57:54 2021 No.36454745
File: 91 KB, 800x800, 7a09b385e91ad441c35cd2a5f88ddf5d[sound=files.catbox.moe%2F1x1yar.mp3].jpg [View same] [iqdb] [saucenao] [google]

>>36454722
>Never fear, Sperg is here!
That's pretty based and kino desu like I'm a super hero!
>The rest of your post
Be quiet before I pop your eyes out... last warning

>>	Anonymous Mon Sep 6 19:58:02 2021 No.36454747 >>36454293 const ange = f => a => x => t => f(a(t)) (x(t));

>>	Anonymous Mon Sep 6 19:58:29 2021 No.36454750 File: 26 KB, 307x295, 1621423318521.jpg [View same] [iqdb] [saucenao] [google] So ... we stopped pretending to like Satoko now? Good.

>>	Anonymous Mon Sep 6 19:58:56 2021 No.36454755 File: 18 KB, 240x400, rhera (3).png [View same] [iqdb] [saucenao] [google] >>36454723 >she Damn sort yourself out.

>>	Anonymous Mon Sep 6 19:59:01 2021 No.36454758 >>36454740 >>36454712 Alright what else does it sound like when you crash? Phusw? Prooh?

>>	Anonymous Mon Sep 6 19:59:56 2021 No.36454768 File: 2.87 MB, 480x270, rika a shit.gif [View same] [iqdb] [saucenao] [google] >>36454750

>>	Anonymous Mon Sep 6 20:00:11 2021 No.36454775 File: 974 KB, 1274x966, when_the_italian_screams.png [View same] [iqdb] [saucenao] [google] >>36454745 He left you... Unworthy.

>>	Anonymous Mon Sep 6 20:00:20 2021 No.36454780 >>36454755 Lion is a girl, The only reason why yasu couldn't have kids is that her ovaries fell out in the fall.

>>	Anonymous Mon Sep 6 20:01:18 2021 No.36454788 >>36454758 I don't know honestly it just made me think of the blompf meme

Anonymous Mon Sep 6 20:02:13 2021 No.36454797
File: 1021 KB, 800x1200, Italianon saves _jp_[sound=files.catbox.moe%2F5082xu.mp3].jpg [View same] [iqdb] [saucenao] [google]

>>36454775
He's just taking a break, The recent state of these threads can take a lot out of a man. He'll be back! I just know it!

>>	Anonymous Mon Sep 6 20:02:36 2021 No.36454801 File: 42 KB, 401x480, rena undertale better.png [View same] [iqdb] [saucenao] [google] do you want to have a bad time kana? kana?

>>	Anonymous Mon Sep 6 20:03:00 2021 No.36454807 File: 105 KB, 1280x720, [muffled meeping sounds].jpg [View same] [iqdb] [saucenao] [google] >>36454750

>>	Anonymous Mon Sep 6 20:03:22 2021 No.36454811 >>36454788 I still cringe when I hear people call trump Drumpf irl...

>>	Anonymous Mon Sep 6 20:03:50 2021 No.36454813 File: 2.36 MB, 2550x3300, 1630377303979.jpg [View same] [iqdb] [saucenao] [google] >>36454797 Imagine being abandoned for arguing about Fallout on /v/ of all things. How sad.

Anonymous Mon Sep 6 20:05:56 2021 No.36454822
File: 49 KB, 640x359, Umineko-fanart-8-umineko-no-naku-koro-ni-26776346-640-359[sound=files.catbox.moe%2Fwhkfg7.mp3].jpg [View same] [iqdb] [saucenao] [google]

>>36454813
You'd have to be mentally insane to post in these threads. Seeing /a/tards roam free in /07/ would drive anyone mad.
heh Lucky for you, I was already insane...

>>	Anonymous Mon Sep 6 20:07:00 2021 No.36454832 >>36454780 Why not just put them back in? Are you an idiot? Anyway Lion is actually Nanjo anyway.

>>	Anonymous Mon Sep 6 20:08:26 2021 No.36454846 >>36454832 They tried to, but nanjo messed up the process leaving her with meat flaps

>>	Anonymous Mon Sep 6 20:11:48 2021 No.36454877 File: 557 KB, 969x1779, enj3_defa1a.png [View same] [iqdb] [saucenao] [google] !

>>	Anonymous Mon Sep 6 20:11:58 2021 No.36454879 File: 1.08 MB, 1276x938, Daco_4599425.png [View same] [iqdb] [saucenao] [google] >>36454758

>>	Anonymous Mon Sep 6 20:13:00 2021 No.36454888 File: 139 KB, 756x874, 1613643493297.jpg [View same] [iqdb] [saucenao] [google] >>36454846 Disgusting unrefined poster.

>>	Anonymous Mon Sep 6 20:14:28 2021 No.36454905 File: 142 KB, 1911x967, ifyougetitYouGetIt.png [View same] [iqdb] [saucenao] [google] >anon doesn't get pic related >(![]+[])[+!+[]] javascript;

>>	Anonymous Mon Sep 6 20:15:29 2021 No.36454914 File: 119 KB, 316x311, 1625942246261.png [View same] [iqdb] [saucenao] [google] >>36454905 javascript devs aren't people

>>	Anonymous Mon Sep 6 20:16:01 2021 No.36454921 Who is the python of WTC?

>>	Anonymous Mon Sep 6 20:16:08 2021 No.36454923 >>36454905 https://ghostbin.com/paste/fCSma

>>	Anonymous Mon Sep 6 20:16:45 2021 No.36454931 Fuck I dropped my ovaries all over this cliff, ....I already hear the seacats pecking away at them........

>>	Anonymous Mon Sep 6 20:17:31 2021 No.36454939 File: 550 KB, 969x1779, enj3_defa1c.png [View same] [iqdb] [saucenao] [google] >>36454905 >>36454923 Very very very based It's quite kino as well.

>>	Anonymous Mon Sep 6 20:18:09 2021 No.36454944 >>36454914 >gets filtered by the esoteric crap in javascript >misses out on a genuinely good functional programming language. Your loss.

>>	Anonymous Mon Sep 6 20:20:17 2021 No.36454970 File: 119 KB, 359x466, enj_waraia1.png [View same] [iqdb] [saucenao] [google] >>36454944 >functional Javascript is object-oriented

>>	Anonymous Mon Sep 6 20:21:17 2021 No.36454976 Tegaki anon, would you mind drawing next a bald Enje?

Anonymous Mon Sep 6 20:21:59 2021 No.36454988

Nᴀᴛsᴜʜɪ ᴅᴏᴇsɴ'ᴛ ǫᴜᴇsᴛɪᴏɴ ᴛʜᴇ ɢᴇɴᴅᴇʀ ᴏғ ᴛʜᴇ ᴠᴏɪᴄᴇ ᴏɴ ᴛʜᴇ ᴘʜᴏɴᴇ
Iɴ ᴛʜᴇ ᴍᴀɴɢᴀ ᴛʜᴇ ʀᴇᴠᴇᴀʟ ᴏғ ᴛʜᴇ ɪɴᴊᴜʀʏ ɪs ᴊᴜxᴛᴀᴘᴏsᴇᴅ ᴡɪᴛʜ ᴘɪᴄᴛᴜʀᴇs ᴏғ ᴀɴ ᴀɴᴀᴛᴏᴍʏ ᴛᴇxᴛʙᴏᴏᴋ, Yᴀsᴜ ᴀɢᴏɴɪᴢɪɴɢ ᴏᴠᴇʀ ʜᴇʀ ʙᴏʏɪsʜ ʙᴏᴅʏ ᴀɴᴅ ɴᴇᴠᴇʀ ʜᴀᴠɪɴɢ ᴀ ᴘᴇʀɪᴏᴅ, ᴀɴᴅ ᴛʜᴇ ʟᴀɴɢᴜᴀɢᴇ Nᴀɴᴊᴏ ᴜsᴇs ᴀʙᴏᴜᴛ ʙᴇɪɴɢ "ᴜɴᴀʙʟᴇ ᴛᴏ ᴍᴀᴋᴇ ᴄʜɪʟᴅʀᴇɴ" ɪsɴ'ᴛ ᴛʜᴇ ʟᴀɴɢᴜᴀɢᴇ ʏᴏᴜ'ᴅ ᴜsᴇ ᴀʙᴏᴜᴛ ᴀɴ ɪɴғᴇʀᴛɪʟᴇ ᴡᴏᴍᴀɴ
Tʜᴇ ᴅᴀᴍᴀɢᴇ ᴀ ᴍᴀʟᴇ ᴄʜɪʟᴅ ᴡᴏᴜʟᴅ ʜᴀᴠᴇ ᴛᴏ sᴜsᴛᴀɪɴ ᴛᴏ ɴᴇᴠᴇʀ ɢᴏ ᴛʜʀᴏᴜɢʜ ᴘᴜʙᴇʀᴛʏ ɪs ᴀ ʟᴏᴛ ᴍᴏʀᴇ sᴜʀᴠɪᴠᴀʙʟᴇ ᴛʜᴀɴ ᴛʜᴇ ᴅᴀᴍᴀɢᴇ ᴀ ғᴇᴍᴀʟᴇ ᴄʜɪʟᴅ ᴡᴏᴜʟᴅ ʜᴀᴠᴇ ᴛᴏ sᴜsᴛᴀɪɴ. ɪɴ ᴡᴏᴍᴇɴ, ᴛʜᴇ ɢᴇɴɪᴛᴀʟs - ᴛʜᴇ ᴏᴠᴀʀɪᴇs ᴀɴᴅ ᴜᴛᴇʀᴜs - ᴀʀᴇ ʟᴏᴄᴀᴛᴇᴅ ɪɴsɪᴅᴇ ᴛʜᴇ ᴀʙᴅᴏᴍᴇɴ, ᴀɴᴅ ɴᴏᴛ ʙᴇᴛᴡᴇᴇɴ ᴛʜᴇ ʟᴇɢs, ᴀs ɪɴ ᴍᴇɴ, sᴏ ɪɴ ᴛʜᴇ ᴄᴀsᴇ ᴏғ Sᴀʏᴏ ɢɪʀʟ, ᴛʜᴇ ɢᴇɴɪᴛᴀʟs ᴄᴏᴜʟᴅ ɴᴏᴛ ʙᴇ ᴀғғᴇᴄᴛᴇᴅ ᴀᴛ ᴀʟʟ. Wʜɪᴄʜ, ʙʏ ᴛʜᴇ ᴡᴀʏ, ɪs ʟᴏɢɪᴄᴀʟ, sɪɴᴄᴇ ɪɴᴛᴇʀɴᴀʟ ᴏʀɢᴀɴs ᴄᴀɴ ʙᴇ ᴅᴀᴍᴀɢᴇᴅ ʙʏ ʜʏᴅʀᴏsᴛᴀᴛɪᴄ sʜᴏᴄᴋ ᴡʜᴇɴ ғᴀʟʟɪɴɢ ғʀᴏᴍ ᴀ ʜᴇɪɢʜᴛ, ʙᴜᴛ ᴛᴡᴏ sᴍᴀʟʟ ғᴏʟᴅs ᴀʀᴇ ɴᴏᴛ.

>>	Anonymous Mon Sep 6 20:22:24 2021 No.36454994 >>36454877 >>36454914 >>36454939 all filtered btw

>>	Anonymous Mon Sep 6 20:23:40 2021 No.36455022 Yasu's sex belongs in the catbox

>>	Anonymous Mon Sep 6 20:23:41 2021 No.36455023 >>36454976 Too late. I'm literally just about to shut off the computer for the night. I missed the backgammon request too.

>>	Anonymous Mon Sep 6 20:24:54 2021 No.36455038 >>36454944 >genuinely good functional programming language Uhh no it's shit the callbacks are really confusing at first

>>	Anonymous Mon Sep 6 20:24:57 2021 No.36455039 >>36454988 I'm not reading this but just know that Yasu is a man, in case you said otherwise.

>>	Anonymous Mon Sep 6 20:24:58 2021 No.36455040 File: 165 KB, 359x466, 1416419834.png [View same] [iqdb] [saucenao] [google] >>36454994 ᴵ ʰᵃᵗᵉ ʸᵒᵘ, ᴵ ˢᶦⁿᶜᵉʳᵉˡʸ ᵈᵉˢᵖᶦˢᵉ ʸᵒᵘ. ˢᵒ ᴵ ˢᵖᵉⁿᵈ ᵉᵛᵉʳʸ ʷᵃᵏᶦⁿᵍ ᵐᵒᵐᵉⁿᵗ ᵗʳʸᶦⁿᵍ ᵗᵒ ᵐᵃᵏᵉ ʸᵒᵘʳ ᵈᵃʸ ʲᵘˢᵗ ᵃ ᵗᶦⁿʸ ᵇᶦᵗ ʷᵒʳˢᵉ. ᴵ ʷᶦˡˡ ⁿᵉᵛᵉʳ ˢᵗᵒᵖ, ᴵ ⁿᵉᵛᵉʳ ʳᵉˢᵗ. ᴵ ᵃᵐ ᴬⁿᵍᵉ

>>	Anonymous Mon Sep 6 20:25:56 2021 No.36455054 >>36455040 >seething tsdr btw

>>	Anonymous Mon Sep 6 20:26:18 2021 No.36455058 >>36454905 >>36454923 Decode this, jsfuck script kiddie. >GCCGGATAGAGTGAGGACCGAAGGTCTACCGAGAGTGGGACTGAATGAAGGATAGAGTACCGCGAGCCGGGGC

>>	Anonymous Mon Sep 6 20:26:51 2021 No.36455065 >>36455058 Looks like Ushiromiya DNA.

>>	Anonymous Mon Sep 6 20:28:00 2021 No.36455084 File: 121 KB, 359x465, enj_defa2.png [View same] [iqdb] [saucenao] [google] >>36455058 [red]Uncaught ReferenceError: GCCGGATAGAGTGAGGACCGAAGGTCTACCGAGAGTGGGACTGAATGAAGGATAGAGTACCGCGAGCCGGGGC is not defined[/red]

>>	Anonymous Mon Sep 6 20:30:22 2021 No.36455109 >>36455065 You're not wrong. Here's something to test your decoder. Ushiromiya = GGGGGTCTGAACGAAGGTCAGATTGATGGAAGGTAGGACG

>>	Anonymous Mon Sep 6 20:31:12 2021 No.36455120 >>36455084 write a script that translates each triplet to its corresponding amino acid right now or you suck

>>	Anonymous Mon Sep 6 20:34:37 2021 No.36455152 File: 51 KB, 500x281, topdandy.jpg [View same] [iqdb] [saucenao] [google] i think i'd feel pretty embarrassed if i were born into some little hick town and my parents forced me to partake in its weird gimmicks

>>	Anonymous Mon Sep 6 20:36:11 2021 No.36455165 >>36444486 Me watching Gou and Sotsu.

>>	Anonymous Mon Sep 6 20:36:36 2021 No.36455170 >>36455165 You make lewd suggestive faces while watching Gou and Sotsu?

>>	Anonymous Mon Sep 6 20:38:14 2021 No.36455189 File: 336 KB, 1920x1080, mion's head.webm [View same] [iqdb] [saucenao] [google] >>36455152 CHOP

>>	Anonymous Mon Sep 6 20:38:18 2021 No.36455191 >>36455170 Don't you?

>>	Anonymous Mon Sep 6 20:38:21 2021 No.36455193 Goodnight to all except the poster who should be banned right now.

>>	Anonymous Mon Sep 6 20:39:17 2021 No.36455202 >>36454970 It isn't a pure OOP language, like say C/C++ The fact that you can pass functions as parameters, makes it a functional programming language. HOFs only exist in functional programming languages

>>	Anonymous Mon Sep 6 20:39:30 2021 No.36455204 Ikuko = Yasu I REFUSE TO EXPLAIN

>>	Anonymous Mon Sep 6 20:39:43 2021 No.36455207 >>36454879 Why is ange making all those weird noises???

>>	Anonymous Mon Sep 6 20:40:18 2021 No.36455214 >>36454988 This makes sense.

>>	Anonymous Mon Sep 6 20:40:44 2021 No.36455218 >>36454888 You're crusin for a brusin bud

>>	Anonymous Mon Sep 6 20:41:45 2021 No.36455226 >>36455204 Good, now I don’t have to hide or filter your shit.

>>	Anonymous Mon Sep 6 20:41:46 2021 No.36455227 >>36455193 And who would that be anon?

>>	Anonymous Mon Sep 6 20:41:52 2021 No.36455230 >>36455038 Callbacks are in Rust as well. Functional Programming Languages use functions for everything.

>>	Anonymous Mon Sep 6 20:43:21 2021 No.36455238 >>36455023 Ok no worries, have a good night

>>	Anonymous Mon Sep 6 21:08:33 2021 No.36455469 File: 145 KB, 952x943, 1629212146893.jpg [View same] [iqdb] [saucenao] [google] >>36455202 >a pure OOP language, like say C/C++

>>	Anonymous Mon Sep 6 21:10:16 2021 No.36455477 >>36455204 don't say that, you'll get a day vacation for spoilers

>>	Anonymous Mon Sep 6 21:14:03 2021 No.36455503 >>36455477 Horrendous loser.

>>	Anonymous Mon Sep 6 21:18:45 2021 No.36455535 >>36454244 same

>>	Anonymous Mon Sep 6 21:24:03 2021 No.36455586 File: 217 KB, 610x603, 1608355056336.png [View same] [iqdb] [saucenao] [google] >>36455503 What's got you so mad?

>>	Anonymous Mon Sep 6 21:33:26 2021 No.36455665 >>36454931 can't you put them back in?

>>	Anonymous Mon Sep 6 21:36:49 2021 No.36455692 >>36454988 what if Nanjo botched really hard the operation and remmoved her ovaries?

>>	Anonymous Mon Sep 6 21:38:16 2021 No.36455704 >>36455204 based

>>	Anonymous Mon Sep 6 21:41:13 2021 No.36455727 >>36451415 Understandable, have a great day!

>>	Anonymous Mon Sep 6 21:43:11 2021 No.36455742 File: 213 KB, 1280x720, 1625159486476.jpg [View same] [iqdb] [saucenao] [google] >>36452084

>>	Anonymous Mon Sep 6 21:46:17 2021 No.36455764 Why is R07 prose so bad in japanese. It's almost unreadable

>>	Anonymous Mon Sep 6 21:49:07 2021 No.36455786 >>36455764 I've seen people say his prose is fine too.

>>	Anonymous Mon Sep 6 21:59:48 2021 No.36455855 >>36455764 Post some particularly bad examples?

>>	Anonymous Mon Sep 6 22:00:46 2021 No.36455863 post Bern cringing

>>	Anonymous Mon Sep 6 22:03:02 2021 No.36455885 >>36455469 Sorry C fag. Rust will always be better than C and C++ because it is a functional language.

>>	Anonymous Mon Sep 6 22:03:41 2021 No.36455892 File: 4 KB, 128x128, 1617902016124.jpg [View same] [iqdb] [saucenao] [google]

>>	Anonymous Mon Sep 6 22:04:21 2021 No.36455901 File: 509 KB, 9999x9999, bern disgust.png [View same] [iqdb] [saucenao] [google]

>>	Anonymous Mon Sep 6 22:07:49 2021 No.36455932 File: 18 KB, 369x315, 168449.jpg [View same] [iqdb] [saucenao] [google]

>>	Anonymous Mon Sep 6 22:11:35 2021 No.36455963 File: 102 KB, 297x416, 1609733269896.png [View same] [iqdb] [saucenao] [google]

>>	Anonymous Mon Sep 6 22:13:58 2021 No.36455984 File: 732 KB, 920x925, 1603997216027.png [View same] [iqdb] [saucenao] [google]

>>	Anonymous Mon Sep 6 22:24:55 2021 No.36456076 File: 206 KB, 357x314, rica_parva.png [View same] [iqdb] [saucenao] [google] >>>>/pol/337952001 Should we be worried?

>>	Anonymous Mon Sep 6 22:29:53 2021 No.36456112 >>36456076 kenyan nipah more like

>>	Anonymous Mon Sep 6 22:33:29 2021 No.36456137 >>36454186 what did you cum to

>>	Anonymous Mon Sep 6 22:38:51 2021 No.36456179 File: 415 KB, 564x720, Cico_ruk_01.png [View same] [iqdb] [saucenao] [google] Deflowering Rukhshana!

>>	Anonymous Mon Sep 6 22:45:27 2021 No.36456218 File: 3.29 MB, 1920x1080, 21079290_p0.png [View same] [iqdb] [saucenao] [google] >>36456076 These two cumrags are always messing with us, aren't they

Anonymous Mon Sep 6 22:45:48 2021 No.36456219
File: 466 KB, 558x720, Cico_roy_01.png [View same] [iqdb] [saucenao] [google]

>>36456179
She's this king's granddaughter, btw. The one who wrote with him in a mental tablet. Rukhshana has also received special permission to join the kette from the king of her country.

>>	Anonymous Mon Sep 6 22:46:44 2021 No.36456225 >>36456076 What the fuck is going on in this world? First the lambda variant then the delta variant now this? We have to spin the chessboard around to understand!

>>	Anonymous Mon Sep 6 22:48:31 2021 No.36456239 >>36456225 >>36456218 Enough with the cringe.

>>	Anonymous Mon Sep 6 22:49:04 2021 No.36456242 >>36455984 satoko should step on there

>>	Anonymous Mon Sep 6 22:49:39 2021 No.36456251 >>36455984 Satoko's expression is the only thing that really matters in this whole picture

>>	Anonymous Mon Sep 6 22:50:16 2021 No.36456257 File: 164 KB, 562x600, But_b25_sakebu2.png [View same] [iqdb] [saucenao] [google] >>36456239 Zen zen dama da... I won't believe that this was all a coincidence! UHOOOOOOOOOOOO!

>>	Anonymous Mon Sep 6 22:52:11 2021 No.36456275 >>36456251 Not Rika's puffy pussy?

>>	Anonymous Mon Sep 6 22:56:57 2021 No.36456313 >>36456275 I couldn't notice.

>>	Anonymous Mon Sep 6 22:57:31 2021 No.36456321 >>36456313 Are you gay?

>>	Anonymous Mon Sep 6 22:58:58 2021 No.36456332 Is being a goat really a bad thing? I have tons of fun making different theories about the Rokkenjima Massacre. I particularly like the "Battler is the culprit" theory, as it really is fun and it would make Ange suffer even more

>>	Anonymous Mon Sep 6 23:00:09 2021 No.36456336 File: 321 KB, 671x767, 1628262389928.png [View same] [iqdb] [saucenao] [google] >>36456332 >"Battler is the culprit" >theory

Anonymous Mon Sep 6 23:05:00 2021 No.36456367

I noticed that I have a hard time having any animosity towards Satoko. Whenever I saw her shoot Teppei it almost felt natural. Same thing with Keiichi, Ooishi and Rika. It's like I accepted in my mind she was just a witch having some fun. The only thing that really mesmerized me a bit was Rena's reaction. But basically, when Satoko does something deemed as awful, I react to her the same way I reacted to Beato in my reread of episodes 1 and 2 of Umineko. Like it's a natural trait she always had. I remember at least having some sort of reaction towards Takano reaching the end of Higurashi, but I cannot dislike Satoko like that for some reason. She just is. I don't process the villain part. I just see another character.

>>	Anonymous Mon Sep 6 23:05:47 2021 No.36456371 >>36456336 care to share how do you think the massacre happened?

>>	Anonymous Mon Sep 6 23:06:00 2021 No.36456373 >>36456313 No, but I think Satoko's face makes me harder than rikunny

>>	Anonymous Mon Sep 6 23:06:49 2021 No.36456384 >>36455764 ......Post............ examples, ......please. ......In other words, ...screenshots.

>>	Anonymous Mon Sep 6 23:07:04 2021 No.36456386 >>36456373 Meant to quote this >>36456321

>>	Anonymous Mon Sep 6 23:07:56 2021 No.36456391 >>36456373 We get it, you're gay.

>>	Anonymous Mon Sep 6 23:09:01 2021 No.36456401 >>36456251 Truth. >>36456373 Same.

>>	Anonymous Mon Sep 6 23:09:05 2021 No.36456403 Mating press Rosa

>>	Anonymous Mon Sep 6 23:09:33 2021 No.36456405 maria

>>	Anonymous Mon Sep 6 23:09:58 2021 No.36456412 >>36456403 's cleavage

>>	Anonymous Mon Sep 6 23:10:54 2021 No.36456418 File: 871 KB, 1137x1071, 74287490_p0.jpg [View same] [iqdb] [saucenao] [google] Dlanor

>>	Anonymous Mon Sep 6 23:11:50 2021 No.36456424 satokoのashi

>>	Anonymous Mon Sep 6 23:12:14 2021 No.36456426 >>36456391 I'm not gay though. Satoko just steals the spotlight there. Had it been Satoko crouching like that, I'd focus on Satokunny. And get even harder

>>	Anonymous Mon Sep 6 23:12:21 2021 No.36456429 >>36456418 's pubes

>>	Anonymous Mon Sep 6 23:12:40 2021 No.36456432 >>36456418 's actually a boy

>>	Anonymous Mon Sep 6 23:14:54 2021 No.36456453 >>36456429 >>36456432 Unfunny shitposts

>>	Anonymous Mon Sep 6 23:15:41 2021 No.36456461 because I'm jealous of the wit

>>	Anonymous Mon Sep 6 23:15:52 2021 No.36456464 File: 305 KB, 1280x718, 1628717071345.png [View same] [iqdb] [saucenao] [google]

>>	Anonymous Mon Sep 6 23:17:24 2021 No.36456475 >>36456464 Based "meeps his legs" poster

>>	Anonymous Mon Sep 6 23:18:05 2021 No.36456481 >>36456453 Since when are Dlanor's pubes supposed to be funny?

>>	Anonymous Mon Sep 6 23:23:53 2021 No.36456536 File: 1.05 MB, 936x1040, 91801799_p0.png [View same] [iqdb] [saucenao] [google] What's the first thing you notice in this image?

>>	Anonymous Mon Sep 6 23:24:12 2021 No.36456540 >>36456481 She’s just a kid.

>>	Anonymous Mon Sep 6 23:24:33 2021 No.36456547 >>36456536 Satoko's butt and backsack

>>	Anonymous Mon Sep 6 23:25:08 2021 No.36456553 >>36456536 Rika's panties.

>>	Anonymous Mon Sep 6 23:25:30 2021 No.36456558 >>36456536 Satoko's ass. It's made so people focus on it.

>>	Anonymous Mon Sep 6 23:27:56 2021 No.36456578 >>36456536 The fact that I’ve already seen this image

>>	Anonymous Mon Sep 6 23:28:10 2021 No.36456579 If Battler was the culprit, do you think he would go on a rampage like Rudolf & Kyrie, or would he kill them one by one like Yasu and Eva?

>>	Anonymous Mon Sep 6 23:28:20 2021 No.36456582 >>36456536 Rena-chan and Mii-chan became lolis for some reason

>>	Anonymous Mon Sep 6 23:28:25 2021 No.36456585 >>36456536 Rena's face

>>	Anonymous Mon Sep 6 23:28:56 2021 No.36456595 >>36456536 Satoko's cute face!!

>>	Anonymous Mon Sep 6 23:29:07 2021 No.36456596 >>36456579 You didn't read Umineko Hane?

>>	Anonymous Mon Sep 6 23:30:21 2021 No.36456604 >>36456582 Clearly not. They're further in the back and the angle is very low.

>>	Anonymous Mon Sep 6 23:30:42 2021 No.36456612 File: 112 KB, 373x459, 1604462503666.png [View same] [iqdb] [saucenao] [google] >>36456579 >If Battler was the culprit

>>	Anonymous Mon Sep 6 23:31:03 2021 No.36456618 File: 97 KB, 415x480, Bu3_majimea3s.png [View same] [iqdb] [saucenao] [google] >>36456579 Have I got news for you.

>>	Anonymous Mon Sep 6 23:34:04 2021 No.36456650 >>36456536 satokos out of frame ashi

>>	Anonymous Mon Sep 6 23:34:25 2021 No.36456654 File: 66 KB, 40x1200, Resized_Screenshot_20210906-192421_Docs.jpg [View same] [iqdb] [saucenao] [google] Okay ill post my theory but only ants are allowed to read it

>>	Anonymous Mon Sep 6 23:35:10 2021 No.36456661 >>36456596 I did, but I feel like Black Battler is too much edgy and different from the real Battler, and I want to know how do you people think Battler would've had done the killing

>>	Anonymous Mon Sep 6 23:35:16 2021 No.36456664 >>36456654 you fool, you posted your cock size and semen count in there

>>	Anonymous Mon Sep 6 23:39:57 2021 No.36456702 >>36456179 anon she lost her virginity when she was 8

>>	Anonymous Mon Sep 6 23:41:37 2021 No.36456723 >>36456654 Just from the images, I can tell that your theory is kind of boring. But holy shit it's wordy for what it is.

>>	Anonymous Mon Sep 6 23:56:53 2021 No.36456826 >>36456650 But her legs are in frame.

>>	Anonymous Tue Sep 7 00:01:11 2021 No.36456862 >>36456654 Just from the size I can tell it's all wrong. Sotsu isn't that complex.

>>	Anonymous Tue Sep 7 00:03:58 2021 No.36456899 >>36456536 Rika's face

>>	Anonymous Tue Sep 7 00:05:34 2021 No.36456916 >>36456862 This

>>	Anonymous Tue Sep 7 00:08:35 2021 No.36456949 >>36456862 >>36456916 You know that some anons are proficient at writing huge walls of text about nothing in particular. Some authors you might know also like to repeat things ad nauseam. The length of a text does not correlate with its complexity.

>>	Anonymous Tue Sep 7 00:11:09 2021 No.36456980 >>36456949 blah blah blah

>>	Anonymous Tue Sep 7 00:12:10 2021 No.36456993 >>36456949 >all that text Bruh, I really hope you don't expect me to read all that

>>	Anonymous Tue Sep 7 00:16:57 2021 No.36457040 Higurashi, but Hanyuu and Eua are succubi.

>>	Anonymous Tue Sep 7 00:17:32 2021 No.36457048 >>36457040 You mean they aren't already?

>>	Anonymous Tue Sep 7 00:22:23 2021 No.36457103 >>36455885 woah we got a functional autist over here

>>	Anonymous Tue Sep 7 00:23:19 2021 No.36457111 >>36457103 transfolx* They're a Rustascean

>>	Anonymous Tue Sep 7 00:23:24 2021 No.36457114 >>36456536 Rika's pantsu followed by Satokobutt

>>	Anonymous Tue Sep 7 00:30:25 2021 No.36457203 >>36457040 So everyone is better off? Just having their life force drained would be a mercy compared to the bullshit they have to put up with.

>>	Anonymous Tue Sep 7 00:31:15 2021 No.36457213 File: 396 KB, 1480x720, Screenshot_20210906-202937_Lithium.jpg [View same] [iqdb] [saucenao] [google] LOL Ryukishi Nevertheless I'm grateful for being introduced into mistery novels. Now I'm off to work out who did it.

>>	Anonymous Tue Sep 7 00:41:32 2021 No.36457295 >>36457040 Isn't Hanyuu already? She canonically had sex

Anonymous Tue Sep 7 00:57:27 2021 No.36457463
File: 176 KB, 640x468, nipah[sound=files.catbox.moe%2F8d4n0r.mp3] (1).webm [View same] [iqdb] [saucenao] [google]

Meeper meeps meep meepe meepy meep meepie meeps. Mii meep meeping meep meep meepard meep meep meeps meep Mii Niipah! meep meepey meep meeped meeps meep meep inmeepable meep meep meeps. Mii! meep meep meepy meepery, meep meeps’ meep meepency meep meep meeps meep meep meepment meep niiipah meep meep miii meeps, meep meep meep meepic miiiiii meep meep meeption meep inmeep.

Mii!s meep meep meep meep meep Mii!ling meeped meep meep meep Mii!lberg meeping meep meeps; meep meep meep meep meeps meep meeper meep meepen meep meep meep meep meep meep meept meepthing meep meepbody?meep meepusly meepable meep-meeption meep meep meeps. Mii! Mii!ry Mii!her meeps meep meep anti-Mii!tian (meep meep), meep meep’s meeply meep anti-Mii!es Mii!nd meeps meep meeps meep meep meep, meepty meep meepment. Mii! meep meeps meep meep meep meep. Mii!, meepfully, meep meep meeper meep meep.

>d-meep meepst meep meeps meep meep meepough d-meep fucking useless Hanyuu.
"Mii!!"
Mii! meeping meep meepful; meep meep meep meepble. Mii! meep meep, Mii! meeped meep meepry meep meep meeper meep meep meep meep, meep meepor meep meeptead meep meep meeper "meeped meep meeps."

Mii! meep meeping meep meep meep meep meep meep meepry meep meep meep meep meeped. Mii! meeped meep meep Mii! meep meeped meep meep meepal meep meeps. Mii! meep meeplous. Mii!ling's meep meeps meep meeped meep meepes meep meep meeps meep meep meep meep meep meep meep meeping. Mii! Mii! meep meep meepish, meeping meep meep Mii!ry Mii!her meep meep meep Mii!phen Mii!ng. Mii! meep meepthing meep meep meepect meep, "Mii! meepse meeps meep meeping Mii!ry Mii!her meep meepmeep meep meepmeep, meep meep meep meep meeper meep meep meep meep meep meep Mii!phen Mii!ng." Mii! meep meep meep meepght. Mii! meep meep meeping meepic. Mii! meep meep "Mii!ry Mii!her" meep meep, meep meep, meeped meep meep Mii!phen Mii!ng.

>>	Anonymous Tue Sep 7 00:59:17 2021 No.36457484 File: 119 KB, 344x411, 1613622467914.png [View same] [iqdb] [saucenao] [google] Click

>>	Anonymous Tue Sep 7 00:59:41 2021 No.36457488 if the gauntlet knights are the pieces, who are the players?

>>	Anonymous Tue Sep 7 01:00:25 2021 No.36457495 File: 535 KB, 1280x720, 1628104157088.jpg [View same] [iqdb] [saucenao] [google] >>36457488 Isn't it obvious

>>	Anonymous Tue Sep 7 01:00:40 2021 No.36457499 File: 583 KB, 929x487, oko.png [View same] [iqdb] [saucenao] [google] >>36457488

>>	Anonymous Tue Sep 7 01:00:41 2021 No.36457500 >>36457488 Mitsuyo and Vier.

>>	Anonymous Tue Sep 7 01:09:07 2021 No.36457604 >>36457495 Why are all those Sotsugou edits fucking cringe?

>>	Anonymous Tue Sep 7 01:10:02 2021 No.36457620 >>36457604 Sotsugou is cringe, Ciconia is cringe, combine them and you get a cringe overdose.

>>	Anonymous Tue Sep 7 01:10:34 2021 No.36457634 >>036457604 >Sotsugou It's sotsugyou

>>	Anonymous Tue Sep 7 01:11:55 2021 No.36457656 sucksogood

>>	Anonymous Tue Sep 7 01:21:02 2021 No.36457773 >>36457634 It's 「ひぐらしのなく頃に業/卒」

>>	Anonymous Tue Sep 7 01:36:05 2021 No.36457945 >>36456536 I don't get this fetish, does the artist like pube sunburns or something

>>	Anonymous Tue Sep 7 01:42:05 2021 No.36458015 File: 2.37 MB, 1900x2400, 92570948_p0.png [View same] [iqdb] [saucenao] [google]

>>	Anonymous Tue Sep 7 02:49:27 2021 No.36458804 File: 398 KB, 568x516, reedempah.png [View same] [iqdb] [saucenao] [google] DO NOT REDEEM NANODESU

>>	Anonymous Tue Sep 7 02:51:52 2021 No.36458818 >>36458804 heh

>>	Anonymous Tue Sep 7 03:36:20 2021 No.36459182 >>36458015 Most delightful pussy in the WTC franchise.

>>	Anonymous Tue Sep 7 03:39:14 2021 No.36459197 >>36458015 INTJ, just like me

>>	Anonymous Tue Sep 7 03:51:00 2021 No.36459263 >>36459182 How would you know?

>>	Anonymous Tue Sep 7 03:52:18 2021 No.36459275 File: 736 KB, 470x263, Ange.gif [View same] [iqdb] [saucenao] [google] >>36434947

>>	Anonymous Tue Sep 7 03:52:25 2021 No.36459278 File: 145 KB, 1137x535, miyao.png [View same] [iqdb] [saucenao] [google]

>>	Anonymous Tue Sep 7 03:57:20 2021 No.36459325 >>36459275 imagine making a thread just to whine.

>>	Anonymous Tue Sep 7 04:08:08 2021 No.36459391 >>36455764 you just don't understand japanese

>>	Anonymous Tue Sep 7 04:09:16 2021 No.36459403 What sort of outfit should I force Enje to wear? I'm half awake right now so if I close my eyes I'm back in my lucid dream.

>>	Anonymous Tue Sep 7 04:09:47 2021 No.36459408 >>36457499 how does he do it?

>>	Anonymous Tue Sep 7 04:10:26 2021 No.36459412 >>36459408 ask ryukishi.

>>	Anonymous Tue Sep 7 04:10:37 2021 No.36459413 >>36459403 shimapan bottom mcdonalds uniform top, hat included

>>	Anonymous Tue Sep 7 04:11:17 2021 No.36459418 >>36459403 Cow bikini

>>	Anonymous Tue Sep 7 04:19:39 2021 No.36459471 >>36459278 Reminder that Miyao has a vagina.

>>	Anonymous Tue Sep 7 04:23:12 2021 No.36459491 File: 73 KB, 750x1000, flat,750x,075,f-pad,750x1000,f8f8f8.u3.jpg [View same] [iqdb] [saucenao] [google] >>36459471 >Miyao is trans just like me Incredible projection.

>>	Anonymous Tue Sep 7 04:30:09 2021 No.36459537 >>36459491 The body belongs to Myao, but Miyao is allowed to exists as her DID friend for shits and giggles.

>>	Anonymous Tue Sep 7 05:17:04 2021 No.36459750 File: 256 KB, 1920x1080, E9coIABXIAM1sxC.jpg [View same] [iqdb] [saucenao] [google]

>>	Anonymous Tue Sep 7 05:28:43 2021 No.36459800 File: 307 KB, 499x720, Cico_miy_50a.png [View same] [iqdb] [saucenao] [google] >>36459471 Kissing Miyao's womb!

>>	Anonymous Tue Sep 7 05:49:53 2021 No.36459911 >>36456654 Post the full theory bro!

>>	Anonymous Tue Sep 7 06:13:26 2021 No.36460046 >>36459911 My theory is that Okonogi is the culprit.

>>	Anonymous Tue Sep 7 06:16:21 2021 No.36460052 >>36460046 I remember reading a image showing all the evidence for Okonogi and it made good sense.

>>	Anonymous Tue Sep 7 06:24:54 2021 No.36460097 Okonogi is the culprit of Higurashi Okonogi is the culprit of Uminekino So he must also be the culprit of Ciconia

>>	Anonymous Tue Sep 7 06:34:03 2021 No.36460138 Okonogi is the single element

>>	Anonymous Tue Sep 7 06:36:47 2021 No.36460146 >>36456239 To end the cringe is to end this general.

>>	Anonymous Tue Sep 7 06:39:44 2021 No.36460156 It's my dream to one day own this island: https://www.youtube.com/watch?v=SBWVKP9EdR0 and begin a dynasty of my own, so that one day I can have them all killed in the greatest murder mystery of all time!

>>	Anonymous Tue Sep 7 06:49:37 2021 No.36460204 >>36457484 ToT

>>	Anonymous Tue Sep 7 07:02:46 2021 No.36460262 >>36460146 Then the cringe will never end...

>>	Anonymous Tue Sep 7 07:03:49 2021 No.36460263 File: 436 KB, 1280x720, Goodnight bros [sound=files.catbox.moe%2Fawudb2.mp3].jpg [View same] [iqdb] [saucenao] [google] Goodnight bros, tomorrow let's shitpost together!

>>	Anonymous Tue Sep 7 07:12:10 2021 No.36460300 >>36460263 Burn in hell sperg

>>	Anonymous Tue Sep 7 07:12:11 2021 No.36460301 File: 53 KB, 162x314, ptg.png [View same] [iqdb] [saucenao] [google] Which one of you did this

>>	Anonymous Tue Sep 7 07:14:42 2021 No.36460313 >>36460300 burn is four letters so what you were really trying to say is "Love uu broo sperg" Thanks bro :)

>>	Anonymous Tue Sep 7 07:15:43 2021 No.36460321 >>36460301 I did! sorry! hahaha! (Whats a private tracker???)

>>	Anonymous Tue Sep 7 07:16:04 2021 No.36460322 >>36460313 Yeah, I love you Sperg don't listen to them! Keep trolling newfags!

>>	Anonymous Tue Sep 7 07:17:09 2021 No.36460327 File: 3.95 MB, 392x448, Epic Dlanor![sound=files.catbox.moe%2Fxvrhi6.mp3].gif [View same] [iqdb] [saucenao] [google] >>36460322 B-B-BASED!!!

>>	Anonymous Tue Sep 7 07:19:57 2021 No.36460344 >>36460321 sekrit club that only the cool kids can access literally the most pointless shit ever

>>	Anonymous Tue Sep 7 07:20:34 2021 No.36460351 >>36460321 A place you can become really obnoxious at and pirate shit, but you need invites

>>	Anonymous Tue Sep 7 07:21:54 2021 No.36460356 >>36460351 Oh, like torrent trackers, but private? What's the big difference?

>>	Anonymous Tue Sep 7 07:22:17 2021 No.36460359 >pirate shit anyone got a link to download switch's higurashi games

>>	Anonymous Tue Sep 7 07:22:35 2021 No.36460361 >>36460344 So what is it they do? Do they track other anons in private like it's a game or something and upload their photos in the thread? >>36460351 That sounds really sketchy!

>>	Anonymous Tue Sep 7 07:23:01 2021 No.36460363 >>36460356 They have shit you can't find on public ones, sometimes. Also you gotta seed your shit or you get kicked.

>>	Anonymous Tue Sep 7 07:23:39 2021 No.36460369 >>36460359 Is it even possible to pirate console games online?

>>	Anonymous Tue Sep 7 07:25:28 2021 No.36460379 >>36460369 You can even emulate switch games, of course you can

Anonymous Tue Sep 7 07:26:46 2021 No.36460385

>>36460361
>Do they track other anons in private like it's a game or something and upload their photos in the thread?
Nah it's basically nyaa except it's private
you have a seeding quota each month, if you fail to reach it you'll get banned (or so I heard)
Private trackers might become actually reasonable in the next decade as piracy gets harder and harder but for now they're pointless.

>>	Anonymous Tue Sep 7 07:28:30 2021 No.36460388 >>36460379 Woah the future is getting pretty cool!

>>	Anonymous Tue Sep 7 07:29:30 2021 No.36460392 >>36460385 Oh, That sounds a lot lamer than what I thought it was.

>>	Anonymous Tue Sep 7 07:34:21 2021 No.36460406 >>36460301 based

>>	Anonymous Tue Sep 7 07:47:25 2021 No.36460470 what version of higurashi has the best sprites

>>	Anonymous Tue Sep 7 07:59:15 2021 No.36460524 >>36460470 Ps3 then original. Final awnser

>>	Anonymous Tue Sep 7 07:59:24 2021 No.36460526 >>36460470 Console=OG>Steam/pachinko guy art. I'd say OG is overall better but console has more variety in expressions and characters.

>>	Anonymous Tue Sep 7 08:39:29 2021 No.36460696 File: 15 KB, 1336x98, Screenshot 2021-09-07 at 4.21.23 AM.png [View same] [iqdb] [saucenao] [google] Reminder to all fucking pedos in these threads who think it's okay to sexualize children! Satoko and Rika ARE CHILDREN!

Anonymous Tue Sep 7 09:08:03 2021 No.36460818

Call me a pedo, call me a milfhunter, call me whatever you want, I'll sexualize sexy older women, children, babies, your family, your children, your sister, your mother, my mother, my children, my sister, my aunt, my grandma, your grandma and release huge ropes of seed while thinking about raping them day and night.

>>	Anonymous Tue Sep 7 09:15:24 2021 No.36460846 >>36460818 Kinda cringe, But also kinda based

>>	Anonymous Tue Sep 7 09:17:19 2021 No.36460861 reddit expansion

>>	Anonymous Tue Sep 7 09:25:39 2021 No.36460888 >>36459275 Thanks

>>	Anonymous Tue Sep 7 09:31:40 2021 No.36460913 >>36460470 Steam, then original.

>>	Anonymous Tue Sep 7 10:00:38 2021 No.36461033 File: 891 KB, 1080x1246, 1625565185386.png [View same] [iqdb] [saucenao] [google] Just finished episode 8 of Umineko. what now?

>>	Anonymous Tue Sep 7 10:04:18 2021 No.36461058 >>36461033 Leave these threads. Don’t come back.

>>	Anonymous Tue Sep 7 10:04:47 2021 No.36461063 >>36461058 alright then

>>	Anonymous Tue Sep 7 10:04:50 2021 No.36461064 I don't mind some lewdposting but lastly it often makes more than 50% of a thread. Thats just degenerate.

>>	Anonymous Tue Sep 7 10:09:56 2021 No.36461089 >>36461064 yeah it's been kinda horny in here for a few days

>>	Anonymous Tue Sep 7 10:09:58 2021 No.36461090 File: 1.37 MB, 1200x1600, 91947337_p0+1.png [View same] [iqdb] [saucenao] [google] Satoko's imouto juices

>>	Anonymous Tue Sep 7 10:18:39 2021 No.36461132 File: 62 KB, 684x383, 92574155_p0.jpg [View same] [iqdb] [saucenao] [google] Haa... come here, Child of Man...

>>	Anonymous Tue Sep 7 10:24:10 2021 No.36461161 File: 958 KB, 3500x3948, 1630252595536.jpg [View same] [iqdb] [saucenao] [google]

>>	Anonymous Tue Sep 7 10:29:42 2021 No.36461233 >>36456367 I'm just sad and disappointed that Ryuukishi made her go through this.

>>	Anonymous Tue Sep 7 11:05:33 2021 No.36461494 >>36457499 Are they twin brothers?

>>	Anonymous Tue Sep 7 11:16:49 2021 No.36461605 File: 724 KB, 1057x1030, VirgiliusOG_(3) (1).png [View same] [iqdb] [saucenao] [google] ITALIANON HERE A JAPANESE GUY LIKED MY TWEET IS HAPPENING

>>	Anonymous Tue Sep 7 11:19:57 2021 No.36461639 >>36461161 the witch of sexual pleasure

>>	Anonymous Tue Sep 7 11:20:28 2021 No.36461645 >>36461161 >>36461639 Pedo fuck off

>>	Anonymous Tue Sep 7 11:23:34 2021 No.36461683 >>36461639 Strange that other witches in Ryuukishi's works don't even have magic wands. She must be the most powerful one.

>>	Anonymous Tue Sep 7 11:25:55 2021 No.36461707 >>36461683 What about the Ushiromiya staff? Those are acceptable.

>>	Anonymous Tue Sep 7 11:31:38 2021 No.36461762 >>36461683 >>36461707 BECAUSE A WITCH IS ANOTHER VERSION OF A REAL EVENT

>>	Anonymous Tue Sep 7 11:32:43 2021 No.36461782 File: 97 KB, 976x845, 1630789199107.jpg [View same] [iqdb] [saucenao] [google] >>36453194

>>	Anonymous Tue Sep 7 11:35:38 2021 No.36461812 File: 6 KB, 240x240, Hitachi-magic-wand.jpg [View same] [iqdb] [saucenao] [google] >>36461707 I don't know, they aren't actual Magic Wands

>>	Anonymous Tue Sep 7 11:43:21 2021 No.36461905 >>36461812 I'm impressed that the artist actually made it look like an actual Magic Wand and not like those generic ones that look different.

>>	Anonymous Tue Sep 7 11:43:30 2021 No.36461909 File: 298 KB, 960x1917, 5fc5e91d0e58809567801b1e53e1110d3ad1a8f0.jpg [View same] [iqdb] [saucenao] [google] >2021 >still do not belive i Erikantrice Why faggots here so cringe?

>>	Anonymous Tue Sep 7 11:46:28 2021 No.36461941 >>36461909 >her

>>	Anonymous Tue Sep 7 11:49:00 2021 No.36461968 >>36461161 I want to protect this smile

Anonymous Tue Sep 7 11:49:26 2021 No.36461976
File: 459 KB, 1696x748, afe2dc0680fa883302ade2a13d1e2dd4184913db.png [View same] [iqdb] [saucenao] [google]

>>36461941
HER
SHANON IS NOT BEATRICE NORMIE

AND BEATRICE IS A WOMAN
WHY?

KINZO WAS AFRAID TO COMMIT THE SAME SIN AGAIN
A MAN CAN'T GET PREGNANT SO YASU IS FEMALE

>>	Anonymous Tue Sep 7 11:51:34 2021 No.36461988 Man, I thought my plan was perfect, but no, he's here

>>	Anonymous Tue Sep 7 11:55:18 2021 No.36462017 Filters on!

>>	Anonymous Tue Sep 7 11:57:02 2021 No.36462033 >>36461683 But Maria and EVAtrice have one, and Beato's pipe is her wand

>>	Anonymous Tue Sep 7 11:57:27 2021 No.36462039 I don't even show stubs, the filter hides the posts completely. It's wonderful!

>>	Anonymous Tue Sep 7 11:57:27 2021 No.36462040 File: 352 KB, 640x775, 1626711766511.png [View same] [iqdb] [saucenao] [google] Are backgrounds in Mei the same as console ports just sometimes with filters or did they redraw them? Or literally the same as alchemists backgrounds? I'm fucking blind

>>	Anonymous Tue Sep 7 11:59:07 2021 No.36462060 >>36462039 FUCKING KEK

>>	Anonymous Tue Sep 7 12:03:33 2021 No.36462142 >>36462040 geiichi

>>	Anonymous Tue Sep 7 12:03:39 2021 No.36462147 >>36462033 See >>36461812

>>	Anonymous Tue Sep 7 12:04:33 2021 No.36462164 >>36462040 AFAIK they are the same. Honestly Mei sprites don't look that bad with those backgrounds.

>>	Anonymous Tue Sep 7 12:06:40 2021 No.36462214 File: 1.98 MB, 1000x767, satocow.png [View same] [iqdb] [saucenao] [google] MOOOOOOOOOOOOOOOOOOOOOO

>>	Anonymous Tue Sep 7 12:08:10 2021 No.36462247 File: 2.53 MB, 2200x3509, 87987568_p0.jpg [View same] [iqdb] [saucenao] [google] >>36462214 Did you know? If you type Nii-Nii, but accidentally one row to the right, it's Moo-Moo

>>	Anonymous Tue Sep 7 12:09:09 2021 No.36462261 >>36462247 Ryukishi is a fucking genius. He planned for Satocow from the start.

>>	Anonymous Tue Sep 7 12:09:37 2021 No.36462277 File: 1.94 MB, 4480x5180, 87908262_p0.jpg [View same] [iqdb] [saucenao] [google] Moo Moo! Moo Moo!

>>	Anonymous Tue Sep 7 12:10:17 2021 No.36462285 File: 477 KB, 830x960, Virgiliu33sOG_(1).png [View same] [iqdb] [saucenao] [google] >>36462214 >>36462247 >>36462261 FUCK OFF COOMERS AND READ HERE THE MANIFESTO https://www.docdroid.net/lnzdHQc/erikantrice-manifesto-pdf

>>	Anonymous Tue Sep 7 12:10:38 2021 No.36462292 Cowtoko or Satocow Which sounds nicer?

>>	Anonymous Tue Sep 7 12:11:31 2021 No.36462311 >>36462292 Satocow always

>>	Anonymous Tue Sep 7 12:14:03 2021 No.36462350 >>36462214 We know Cowtoko >>36447443

>>	Anonymous Tue Sep 7 12:14:30 2021 No.36462360 File: 828 KB, 1000x1000, 1617971114798.jpg [View same] [iqdb] [saucenao] [google] >>36462292 Satocow.

Reply to thread

Name
E-mail
Subject
Comment
Action

Advanced search
Text to find
Subject [?]Search by post subject. Leave empty for any.
Username [?]Search for user name. Leave empty for any user name.
Tripcode [?]Search for tripcode. Leave empty for any.
Email [?]Search by email. Leave empty for any.
Filename [?]Search by image filename. Leave empty for any.
From Date [?]Enter what date to start searching from. Format is YYYY-MM-DD
To Date [?]Enter what date to start searching until. Format is YYYY-MM-DD
Image hash
Search in	All Posts OPs Only
Deleted posts	Show all posts Show only deleted posts Only show non-deleted posts
Internal posts	Show all posts Show only internal posts Show only archived posts
Order	New posts first Old posts first
Capcode	All Posts Only by Users Only by Mods Only by Admins Only by Developers
Results	Posts Threads
Action	[ Simple ]

/jp/ - Otaku Culture