Monster Girl Thread

[Anonymous No.]

Dark Spirit Phantom has invaded!

Monster Girl Pastebin: http://pastebin.com/UevqvF4h

Monster Girl Wordpress: http://monstergirlscollection.wordpress.com

[Anonymous No.]

First for redcaps a best

[Anonymous No.]

Wendies running through the leaves!
The winter pack is beginning their exercises for the coming winter!

[Anonymous No.]

>>17695631
Cursed Swords are good too.
Nothing says "I love you" more than a monster girl repeatedly stabbing you.

[Anonymous No.]

Itty bitty kitty tiitties.

[Anonymous No.]

>>17695629
Reposting from last thread, new from line 81.

https://pastebin.com/469vGwhJ

[Anonymous No.]

>>17695640
Silly cat.
Apples are your downfall!

[Anonymous No.]

>>17695629
Will o wisps are so wonderful but nobody likes them. I would consider suicide for a tsundere, twintailed Wisp.

[Anonymous No.]

No, I would not buy wendigo cookies.

[Anonymous No.]

>>17695636
Everyone loves the love bats.

[Anonymous No.]

>>17695644
I now feel dumb for confusing Will O'Wisps and Phantoms for the OP, fug.

[Anonymous No.]

>>17695636
I think this happens shortly after some Anon giving a suspicous looking sword to his crush as a gift.

[Anonymous No.]

>>17695651
I forgive you, but date a Wisp

[Anonymous No.]

>>17695647
>This makes the Wendigos cry

[Anonymous No.]

>>17695658
>Date a Wisp!
>What's the worst that could happen?

[Anonymous No.]

>>17695661
I'm sure she would understand if I said I was full and in a hurry.

[Anonymous No.]

>>17695545
Interesting, care to explain why?

[Anonymous No.]

>>17695661
>Tell a wendiscout you're too full to buy cookies.
>She gets confused at how anyone can be full.

[Anonymous No.]

Busty cowdaver.

[Anonymous No.]

>>17695648
I pity anons who don't experience the lovebat on a daily basis.

>>17695652
Men don't give girls cursed swords, only shady foreign racoon's and Demons.

[Anonymous No.]

>>17695672
Thick and busty is how I like my undead.

Going to make an undead realm dedicated to it.

[Anonymous No.]

[Anonymous No.]

How do I get rid of a moth

[Anonymous No.]

>>17695671
Would I need to explain to her the difference between humans and abominations? Maybe she should find a better place to sell those cookies.

[Anonymous No.]

>>17695666
an eternity of sex, games, and cosplay with a NEET Wisp.

[Anonymous No.]

>>17695685
Yes.
This wendi needs a lesson.

They haven't covered physical differences between humans and chaos girls.

[Anonymous No.]

>>17695634
The pack has found its prey.

[Anonymous No.]

>>17695693
Alright then, give the pack of wendies, a bunch of chairs and some books. From now on I'm teacher anon.

[Anonymous No.]

>>17695684
Turn off all the lights in your room and turn on the lights in your single friends' rooms.

[Anonymous No.]

>>17695699
It is too late for the man, he has already been surrounded.

Amidst the leaves and cooling air, the wendigos will feast this day, dragging whatever remains back to their cave.

I'm Morgan Freeman and you've read this entire statement in my voice.

[Anonymous No.]

>>17695712
Didn't work this time. Sorry anon.

[Anonymous No.]

Hugh Hefner
1926-2017

[Anonymous No.]

>>17695703
Just be sure to keep a few of them from gnawing on their books, they may not be hungry but they need to work their teeth until their adult ones come in.

>>17695715
I'd watch an "Earth" style documentary on monster girls if it was narrated by Morgan Freeman.

[Anonymous No.]

>>17695693
I just realized this had a lewd meaning behind it. Those poor wendigos would be extremelly frustrated now.

[Anonymous No.]

>>17695716
The original Harem protag.

[Anonymous No.]

I had this dream.
A dream where you turned into a shota and was transported to the middle of a city populated entirely by chubby baby-crazy CC monster girls.

Better be careful, they can smell your fear.

[Anonymous No.]

>have a harem of five shortstack khepris
>you do your best to keep them pregnant at all times
>usually when one girl is empty, you'll fuck her until she's cumflated while the others do non-strenuous chores around the house
>sometimes one of the others will watch as you do this, masturbating while wishing she could pop out a cute daughteru for you so she can get started on the next one

[Anonymous No.]

>>17695735
Would be nice, although I'd keep them plugged up in the meantime so they don't spill.

[Anonymous No.]

>>17695720
There would be a specific time to chew on the sticks or other objects, but I'd need their full attention during class. When thry get out they will be pros on human anatomy and physiology.

[Anonymous No.]

>>17695734
That sounds like my kinda dream. Getting lovingly femdommed by thicc momsters aching to be filled with daughters would be the best.

[Anonymous No.]

>>17695734
>they can smell your fear
That means it would be easier for me to go unnoticed.

[Anonymous No.]

>>17695745
Good man.
Education is a powerful tool for wendis.

[Anonymous No.]

>>17695716
>Made porn mainstream and highbrow
>Rebelled against 1950s straight-laced society
>Created the phrase "I read it for the articles" so now we can say "I read it for the plot"
>Invented the iconic bunny-girl outfit

[Anonymous No.]

>>17695735
>>17695742
Please don't cumflate the Khepris, you will repopulate the Desert Kingdoms at this rate. Then you'll have to handle several villages' worth of married couples, and their agricultural activities.

[Anonymous No.]

>>17695766
It'll be fine.
I imagine its largely possible due to mamobamma.

May save up on special occasions for some alchemical enhancers to really give them a show so they can take the rest of the day off.

[Anonymous No.]

>>17695716
>>17695764

How would MGs honor the loss of this man?

[Anonymous No.]

>>17695788
Guess.

[Anonymous No.]

>>17695788
Bunny suits for everyone.

[Anonymous No.]

>>17695792
Monster girls in bunny suits is a trend I could get behind. Especially all the high level ones like Pharaoh, Wight, Demon, Dragon etc.

[Anonymous No.]

>>17695788
DL would probably award him the Medal of Freedom

[Anonymous No.]

>>17695807
I want to see an Automaton wearing one while questioning her master/husband as to the point of the garment.

[Anonymous No.]

>>17695791
>Wight has her claws out
That anon's not getting away.

[Anonymous No.]

>>17695807
Didn't Barb post something like that a few months back? A Hakutaku and two other CCs in bunny suits. I thought I saved it but apparently not.

>>17695829
Of course he isn't. Royalty gets what royalty wants.

[Anonymous No.]

>>17695834

[Anonymous No.]

>>17695828
>"Master, this outfit is impractical. Wouldn't you rather just see me naked?"
>>17695834
>Didn't Barb post something like that a few months back? A Hakutaku and two other CCs in bunny suits. I thought I saved it but apparently not.
He did, Titania is high level so she totally counts.

[Anonymous No.]

>>17695843
I'd haku that taku.

[Anonymous No.]

>>17695843
Ah, much obliged.

>>17695849
I imagine an Automaton would be down with most things to please mastah. No reason for her to object if it makes him happy.

[Anonymous No.]

>>17695807
I'd love to see a dragon weaeing a bunny suit while being slightly embarrassed. I'd go at it like rabbits with her.

[Anonymous No.]

Hope she doesn't jam her claws straight through me.

[Anonymous No.]

>>17695873
I wonder if haughty girls are weak to anal.

[Anonymous No.]

>>17695792

[Anonymous No.]

>>17695896

[Anonymous No.]

>>17695897
It's only natural.

[Anonymous No.]

>>17695901
She just needs to get into the rhythm.

>>17695903
Ok then.
Time to try anal with dragon senpai!

[Anonymous No.]

>>17695897
Yes they are. Dragons even more so because you can play with her tail to increase the pleasure.

[Anonymous No.]

>>17695908
Nothing better than molesting a big, scarred red dragon's tail while pounding her tight rear.

[Anonymous No.]

>>17695901
I want to stick my dick between her asscheeks while she beats the Taiko drums.

[Anonymous No.]

>>17695910
Indeed. Biting her is great too and if you let her tail free you get so see her wrapping it around your waist to pull you closer. You can also hug her from behind and whisper sweet nothings in her ear to get some really lovely dragon heartpupils.

Damn I want to fuck my dragon.

[Anonymous No.]

Memes?

[Anonymous No.]

>>17695899
Everyone talks about the meaty paws KC does but never talks about the meaty thighs he exaggerated on the rabbits. You could easily rest your head on those like a pillow without even resting on her actual thigh itself

[Anonymous No.]

>>17695668
I don't know. I've always enjoyed the Wendigo artwork but the actual setup and eventual sex turned me off. I guess I'm just not cut out for eldritch loving. Maybe something more like a white horn is more my speed.

[Anonymous No.]

>>17695680
Looks kinda peaceful.

[Anonymous No.]

>>17695925
Is that a problem?

[Anonymous No.]

>>17695901
>When you got rhythm in bed but none outside of it

Hopefully some no good Cheshire doesn't roll up and serve her and finishes her off with something like "The only place you got rhythm is in the bounce house!"

[Anonymous No.]

Mere female lizards

[Anonymous No.]

>>17695956
Did that dragon switched bodies with a wurm? They should bonk their heads together as soon as possible.

[Anonymous No.]

>>17695956
Why do artists rely so heavily on chromatic aberration?

[Anonymous No.]

>>17695961
Japanese tradition requires adding 1-3 filters to any work of art before you can publicly post it.

[Anonymous No.]

>>17695956
I prefer this dragon.

[Anonymous No.]

>>17695967
I don't think that artist is Japanese.

[Anonymous No.]

>>17695977
I like this one myself, even if barbs Gold dragon is by far the lewdest.

[Anonymous No.]

>>17695978
I realize that, but I see that behavior most frequently among JP artists.
For them, no picture is finished without a few unnecessary filters.

[Anonymous No.]

>>17695985
Like social media photos?

[Anonymous No.]

>>17695897
The more haughty, prideful, prudish or innocent they are, the better for anal they are.

[Anonymous No.]

>>17695949
Cheshires are the ones who'll definitely laugh at you when you fail at rhythm games.

[Anonymous No.]

>>17695981
Red dragon is the best though. Best hair, best clothes, best atittude and best ass.

[Anonymous No.]

>>17695959
What will happen if that knight says she's too heavy?

[Anonymous No.]

>>17695977
She is going to bite or burn you, run away!

[Anonymous No.]

>>17696011
She latches on and flies, saying that she'll drop him if he doesn't apologize.

>>17696012
The right thing to do is kiss her.

[Anonymous No.]

>>17696012
Coward, it's an invite for dragon blowjobs. Imagine how warm that mouth is.

[Anonymous No.]

>>17695672
I want that Lich to force me to drink her milk

[Anonymous No.]

>>17696015
>>17696019
Brave men get great dragon wives.

[Anonymous No.]

>>17696023
I want to visit the most fertile Undead Kingdom.

[Anonymous No.]

>>17695788
inconsolable weeping

[Anonymous No.]

I want to star in the monstergirl version of Emergence

[Anonymous No.]

>>17696048
Remember that breathing too much of the air there will turn you into an undead too. It probably also attracts the inhabitants to you too.

[Anonymous No.]

>>17696033
I wouldn't mind a loud and commanding dragon who just happened to prefer being on bottom. Rather than moaning like a japanese porn star or becoming a mere lizard she would roar encouragement and call me out on holding back on her.

[Anonymous No.]

BIG
FAT
SNAKES

[Anonymous No.]

>>17696101
I hope the snakes stay far away while we fuck.

[Anonymous No.]

What would happen if anon had a ghost waifu during his life but died? Would he become a ghost to live with his girl in the afterlife?

[Anonymous No.]

>>17696120
I think so.

[Anonymous No.]

>>17696101
I don't know, she seems liable to eat me, and not in the sexual way.

[Anonymous No.]

>>17696099
Yeah, I prefer switches or power bottom dragons than pure female lizards one. They are way more fun to play around with.

[Anonymous No.]

>>17695988
Big
Fat
Venom
Sacks

[Anonymous No.]

:3

[Anonymous No.]

>>17695897
Meme threadcanons are cancer

[Anonymous No.]

>>17696147
>he thinks haughty buttsluts are threadcanon

[Anonymous No.]

>>17696161
Knowing these threads, it will apply to all haughty monstergirls because haha they're haughty.

As shit as ruining Anubis with the same.

[Anonymous No.]

>>17696115
Just be glad they don't talk.

[Anonymous No.]

https://i.imgur.com/77D4imL.jpg

[Anonymous No.]

>>17696175
The intestinal walls are made to absorb things.
It's like how butt chugging gets you wasted super fast, but with spirit energy.
There's an idea. Pour some alcohol in her ass and them jam your dick in.

[Anonymous No.]

>>17696193
>Pour some alcohol in her ass and them jam your dick in.
Now that's a bad idea.

[Anonymous No.]

>>17696189
>>>/lgbt/
This thread is not for post-op trannies.

[Anonymous No.]

>ywn wake up inside the warm and cozy coat dimension of your Wendigo waifu.
>Before you can even pour some milk in your cereal she throws a slain boar through the coat leading to reality.
>"Hey hun. Whatcha got there?" You ask.
>With a smile on her face she replys "Breakfast! For both of us! Come help me gut this big boy!"
>With a sigh you pour the cereal back into the bag and return the milk to the fridge.
>You decide that bacon and eggs with you wife sounds nicer than boring old cereal.

[Anonymous No.]

>>17696175
There's no need for butthurt

[Anonymous No.]

>>17696206
>ywn have a meat glutton wendigo waifu

[Anonymous No.]

>>17696206
What does the coat dimension look like? I imagine it as the inside of a cozy log cabin in the middle of a perpetual snowstorm.

[Anonymous No.]

You can't run from a big spider's love.

[Anonymous No.]

>>17696262
But I want a medium spider...

[Anonymous No.]

>>17696261
I've always thought it as something that can change. So when moving around it acts just as a big, cozy coat, but when resting it's like what you said, a log cabin or a nice campfire.

[Anonymous No.]

[Anonymous No.]

>>17696272
I like this artist.

[Anonymous No.]

>>17696261
In my headcannon when the husband gets absorbed for the first time and the coat takes his unique spirit energy in, it manifests a place of comfort for the husband. But when you look out of the windows and actually leave the cabin you see a peaceful snowfall like in a lightly shaken snowglobe and a forest in the distance surrounding you. It also slightly obvious that you aren't inside your original reality.

[Anonymous No.]

>>17696272
Fancy Imp. For summoning to take to fancy occasions.

[Anonymous No.]

>>17696280
So do Wendigos have a code of honor to hang up empty Wendigo coats because they know that wendigo's husband just pulled her in for cuddles and hot chocolate?

[Anonymous No.]

>>17696262
I don't much like spiders Mr. Anon

[Anonymous No.]

>>17696262
Oh I aint runnin. I love me some fuzzbutt.

[Anonymous No.]

>>17696290
But she really likes you. She's going to impress you by breaking that chain with her claws.

[Anonymous No.]

>>17696293
How hard do you think you could make an Arachne delinquent blush by leaping into her arms when she tries to chase you down?

[Anonymous No.]

>>17696294
I really want to see some really tough monster girls try and court a man. Like throwing a rosebush at his door or something.

[Anonymous No.]

>>17696287
Thankfully there are a bunch of branches around and the Wendigo can use them to hang up the coat before getting pulled in by her husband. In the case he is too quick for her thats when the those big arms you see in the profile picture come out and the coat drags itself somewhere hidden. But this is all just autistic headcannon for my waifu lol.

[Anonymous No.]

>>17696294
I'm gonna call the authorities this neighborhood doesn't need spiders breaking everyone's stuff

[Anonymous No.]

>>17696262
No, but my actual waifu knows how scared I am of spiders and has some rather nasty spells for occasions such as this.

[Anonymous No.]

>>17696262
I have arachnophobia, does she wants me to have a heart attack?

[Anonymous No.]

>>17696295
So hard she drops you because she has to cover he bright red face.

[Anonymous No.]

>>17696304
Well now you've got a big strong Police Hound, kabedonning you against a wall asking what the problem is.

[Anonymous No.]

>>17696287
Not him, but I imagine if they both enter, er, coatspace, then to an outside viewer it'd look like the coat just folded in on itself and vanished.
It's not like the eldritch have a high priority on logic.

[Anonymous No.]

>>17696298
Wurms would break through a building to carry the guy away. Or drop a boulder in his lawn as a gift.

[Anonymous No.]

>>17696326
That boulder's actually a huge, beautiful geode.

[Anonymous No.]

>>17696326
>>17696330
https://www.youtube.com/watch?v=yTOwMeimSl4

[Anonymous No.]

I wish she stopped over-exerting herself

[Anonymous No.]

>>17696310
This city is nothing but trouble!

[Anonymous No.]

>>17696337
If you refuse to comply, she'll arrest you and send you to a clubhouse filled with jaded CC Succubi.

[Anonymous No.]

Cthulhu-chan

[Anonymous No.]

>>17696362
Can I go with her instead?

[Anonymous No.]

>>17696365
Ugly!

[Anonymous No.]

>>17696365
I hear she's lonely and clingy as fuck. Last time she had visitors, she chased them into the sea when they tried to leave her behind

[Anonymous No.]

>>17695938
Looks are deceiving when koopas are involved!

[Anonymous No.]

>>17696431
[EMBARRASSED KAPPA NOISES]

[Anonymous No.]

>>17696365
Having sex with Cthulhu-chan is a mind shattering experience that only the most insane of men could survive.
I'd rather have go with one of her daughters.

[Anonymous No.]

>>17696469
What if you bone her while she's sleeping?

[Anonymous No.]

>>17696479
I guess that could work, but then you'd have to commit to fucking her until she awoke and by then you would have become the most insane man.
Why not just go for a cute Cthylla instead? She might leave you with a shred of sanity if you please her

[Anonymous No.]

>>17695843
Is there a higher resolution of this pic?

[Anonymous No.]

>>17695843
Good thing that CC Flayer is married. There's no telling what she'd do if she manages to get her hands on a shota.

[Anonymous No.]

>>17696511
Shota minds are a treat to flayers. Their panic and fear is so good and they can be quite creative too.

[Anonymous No.]

>>17696535
All those sweet innocent thoughts must have a special taste to them.
A flayer would especially enjoy the ever changing mind of a boy hitting puberty.

[Anonymous No.]

>>17696535
I bet they eat the memories at the end so they can "deflower" the shotas over and over.

[Anonymous No.]

>>17696560
I imagine a flayer goes through your mind like walking through a library.
>Wow! What an amazing collection of thoughts in here.
>Is he really looking at every single girl to see if she likes him? The poor sweetie is desperate.
>Ooh, the hall of fetishes. Let's see...
>Oh dear.
>Oh my.
>Let's get rid of that one while we still can.
>TFW a mindflayer will never save you from being alped or ruined by your middle school fetishes

[Anonymous No.]

>>17695977
I prefer one with red hair.

[Anonymous No.]

>>17696560
>>17696575
The taste of his thoughts when she takes his virginity would be so good, she'd probably flay herself just to experience it again.

[Anonymous No.]

>>17696146

Uhh...yeah I'm gonna ask you to never do that in front of me again.

[Anonymous No.]

>>17696587

Why not flay him and have sex at the same time?

[Anonymous No.]

>>17696591
That's what I said she'll be doing. She'd get those lewd thoughts right as they are formed and it would probably make her cum over and over again.

[Anonymous No.]

>>17696601

Oh, sorry must've misread it as immediately after rather than during.

In any case that would be quite the feedback loop.

[Anonymous No.]

>>17696601
One of the scenes in the MGE game last year involves the heroine turned into a Flayer and starts raping her squire. She inserts her tentacles into his ears shortly afterwards.

[Anonymous No.]

>>17696575
How would a Mindflayer feel if she took a deep look into someones mind only to find that within someone's fears and nightmares was being mindflayed?

[Anonymous No.]

>>17696669
She'd probably laugh and think how silly the person is before breaking them a bit more, followed by a hearthy amount of rape.

[Anonymous No.]

>>17696669
Fears and nightmares? Lets flay that to fetishes and dreams. It just makes everyone happier.

[Anonymous No.]

>>17696669
She probably wouldn't be surprised, but she would set about removing said fear.

[Anonymous No.]

What stories are you guys reading?

[Anonymous No.]

>>17696706
Losenis' Lilim story. Currently on chapter 6 and I'm liking it.

His lilim really doesn't act or is strong enough to feel like a lilim, but she fits the story nicely. Also, Lose if you're reading this there was an error in line 255 of part 4.

[Anonymous No.]

>>17696731
>Lose if you're reading this
Heyo. Fixed now.
The lilim is naive at the start. In a certain chapter it's revealed how painfully easy it'd have been for her to stomp Nostrum to the ground, had she had the proper mindset to actually want to stomp them mercilessly, but I won't spoil you how or when.

[Anonymous No.]

[Anonymous No.]

>>17696780
Big cow.
Grope now.

[Anonymous No.]

>>17696706
HumbleSacrifice's new story.
10/10 kunoichi, not so keen on the treason.
Why can't all MGs be as gentle as her? I want one.

[Anonymous No.]

>>17696780
>those thighs

I think I'm looking in the wrong place

[Anonymous No.]

>>17696706
Lanternon's second story. Unlike the first one I can't really guess what's happening here, the original was easy to work out (the final hero denied his quest thing was obvious from the first few chapters if you thought about it) but I have no idea where Lanternon is going with this Paladin story.

[Anonymous No.]

>>17696765
Also people need to remember that the godlike lilims so far described only seem to be the very eldest ones. I wouldn't be surprised if younger ones are more like special succubi than the city-conquering demons we see them all as.

[Anonymous No.]

>>17696765
>Does the dab
>Too cutely naive to crush the enemy country trying to exterminate her nation
>Delicious Esdeath fetish wear
>The hat meme

Victoria really is bullyable isn't she?

[Anonymous No.]

>>17696857
She's not bullyable stfu

[Anonymous No.]

>>17696865
Well, I mainly want to "bully" her by giving her a hug and rubbing my cheek against hers like a cat. Gap moe in supposed evil overlords is my critical weakness.

[Anonymous No.]

>>17696873
You have bad taste

[Anonymous No.]

>>17696873
This makes the lilim blush

[Anonymous No.]

>>17696873
I want to do something similar but in front of the lilim's entire court

[Anonymous No.]

>>17696891
>Lilim trying to be really intimidating and imposing in front of all her court of super powerful and/or important monstergirl nobles.
>They're all just trying to keep from busting out laughing because her husband is acting as her seat cushion and can't stop stroking her hair while cuddling her.
>At least four of them have had to excuse themselves to go laugh their heads off.
>Five of them, three of them generals in the Lilim's army, had to excuse themselves to go masturbate because they got flustered.

[Anonymous No.]

>>17696902
>Lilim keeps talking about her throne when she's away. not seeing the time she returns to it
>Her companions are confused as to why she'd talk about it so much
>They're none the wiser about her throne being hubby's lap rather than the actual throne she has

[Anonymous No.]

>>17696765
Yeah, it's the vibe I'm getting from her. She has potential but at least until now she's a growing dork.

There was a mistake in part five I think. Rosario was writen as rosarii.

[Anonymous No.]

>>17696927
Intentional. Rosarii as plural for Rosarius.

[Anonymous No.]

>>17696933
Really I didn't know about that. The more you know.

Gotta say, when I saw that "hat" mistake I had a hearty giggle though.

[Anonymous No.]

Chaosfags deserve the flame.

[Anonymous No.]

>>17696953
Just nachos, really.

[Anonymous No.]

>>17696953
Why stop there? Gorge your hatred. Embrace your rage.

[Anonymous No.]

>>17696953
>Are you the one trying to burn my husband?

[Anonymous No.]

Big, busty, innocent, arachnes.

[Anonymous No.]

>>17696968
>innocent
>arachnes
doubt.jpg

[Anonymous No.]

>>17696953
Don't worry anon. I'll give a nacho my mixtape that is so hot, she won't even be able to spin more web.

[Anonymous No.]

>>17696974
I've heard caffeine works just as well in that regard.

[Anonymous No.]

>>17696972
Not all of them are masterful seductresses, some are just big old sweeties that make you sweaters.

[Anonymous No.]

>>17696981
Hot coffee with my mixtape. That's how we destroy nachos.

[Anonymous No.]

>>17696958
>Spoiler
Explain.

[Anonymous No.]

>>17697014
Erase this pointless world and move on to the next, anon. Why should they be happy while you suffer?

[Anonymous No.]

Meow meow motherfucker.

[Anonymous No.]

>>17697027

Life is simply unfair don't you think?

There are moments when a single Tritonia can make a world go extinct

[Anonymous No.]

>>17697027
I want the chaosfags to leave

[Anonymous No.]

>>17697034
But shouln't it be?
Nyather fucker?

[Anonymous No.]

>>17697047
Meowtherfucker.
A Cheshire momster would be nice.

[Anonymous No.]

>>17697027
Go away Bollocks

[Anonymous No.]

>>17697055
It's only a matter of time till her smug pranks go from innocent to lewd.

[Anonymous No.]

>>17697055
I'd be doing the spanking rather than the other way around if I had a pun spewing cheshire momster

[Anonymous No.]

>>17696780
moo snu!

[Anonymous No.]

Getting kissed by a Hellhound

[Anonymous No.]

>>17697056
Literally who?

[Anonymous No.]

>>17696953
Surrender yourself to the love of our lord and be bathed in ecstasy for the rest of your days!

[Anonymous No.]

>>17697099
No. How can the Great Old Ones themselves have forgotten their purpose?

[Anonymous No.]

>>17697034
>That one memecat who always sits on your head whenever you're studying in the library

[Anonymous No.]

>>17695634
Wendigos with brown fur coats and light scarves for autumn

[Anonymous No.]

>>17697099
He's already coloring her? Nice.

[Anonymous No.]

>>17697121
I know monstergirls don't wear undergarments, but a big bootied schoolgirl Cheshire would look lovely wearing purple striped shimapan.

[Anonymous No.]

>>17697129
Little wendis are cute.
Also gives them good camo and makes me wonder if they have lighter, green colored coats for summer and spring.

[Anonymous No.]

>>17697143
Wendis usually live high up in the mountains where it's probably cold all year round.

Still, would a Wendi ditch her coat at the beach?

[Anonymous No.]

>>17697078
>He's not wearing a collar too
So close to perfection.

[Anonymous No.]

>>17697189
Maybe, but I imagine that some wendis live on the the lower edges of mountain ranges where they do see green and other leaf colors.

[Anonymous No.]

>>17697069
>you will never aggressively prone bone your Cheshire momster

[Anonymous No.]

I can't stop thinking about fluffy rabbit thighs

[Anonymous No.]

>>17697209
She won't get my dick if she keeps punning!

[Anonymous No.]

>>17697220
March Hares disturb me on levels I didn't know existed. You literally can't reason with them.

[Anonymous No.]

>>17697220
They do seem like the best pillows, don't they? They're also so strong that you'll never get out of their leg-lock.

[Anonymous No.]

>>17697079
Some piece of shit writer people want to come back

[Anonymous No.]

>>17697220
die bunners

[Anonymous No.]

>>17697078
This does things to me.

[Anonymous No.]

>>17697220
You think they can pull off that dip-and-serve like the ones in Chicago?

Also, for some reason the March Hare remains my favorite from the Wonderland set. The things I'd do to her if I ever got the chance.

[Anonymous No.]

>>17697257
>wanting anything to do with Wonderland

Something something absolute madman.

[Anonymous No.]

>>17697220
To succeed with rabbits you have to focus on how deliciously plump and wide set her hips are, like pure baby-making hips that slam onto you with the force to nearly pulverize your pelvis.
The kind of FUCKMONSTER that won't pull you out or let you go until she has an entire litter of bunnies in her.

[Anonymous No.]

>>17697257
Like wha, Anon?

Would you give her a deep kiss?
Would you tear off her clothes and motorboat her breasts?
Would you spin her around, bend her over, and proceed to raper her thighs?

I assume that would just be the beginning

[Anonymous No.]

>wendigo doing this inside her coat

[Anonymous No.]

What do monstergirls eat besides semen if no other animals exist? Other monstergirls?

[Anonymous No.]

>>17697319
This is what happens when Wendi gets too much candy on Halloween!

[Anonymous No.]

>>17697325
You are now the dumbest motherfucker in this thread at the moment, congratulations.

[Anonymous No.]

>>17697325

They just starve to death basically

[Anonymous No.]

>>17697294
She'd probably be on me the moment our lips met, leaving no time for anything but each other and how many times we can.

[Anonymous No.]

>>17697329
Thanks. Can you answer it though?

[Anonymous No.]

>>17697220
And rabbit fur is actually soft unlike fox fur

[Anonymous No.]

>>17697342
Rude.

[Anonymous No.]

>>17697338
It shouldn't need an explanation when your lazy ass could just gander through the wiki.

[Anonymous No.]

>>17697220
>Go camping innawoods
>All prepared for mantis, grizzly, etc.
>Didn't expect this, though
>"Gosh! How do you hear out of such tiny ears?"
>You don't know how this rabbit got into your tent, but now she was pinning you down, her supple chest on full display as she leans over you
>Drawing closer, her fluffy legs and thighs begin to brush against your body as she starts teasing your ears, a cheery smile on her face
>Under your breath, you curse your decision to sleep shirtless; Why was it so hot last night?
>You freeze as an immense pleasure assaults your senses
>"Heh heh, oopsie daisy"
>Her foot had somehow hooked on to yoir waistband, and now dragged your pants down
>"Do you like that?"
>Words fail you as she begins rubbing her soft thighs on your exposed nether regions
>"You're blushing so hard right now! Are you exited?"
>She leans in and gives you a quick peck on your cheek
>"You seem pretty excited down here!"
>In moments, she locks those irresistible thighs about your waist
>You have a feeling it will be some time before she lets you go

[Anonymous No.]

>>17697327
it's that time of year too, it's the responsibility of every coat abomination husband to supervise his wendigo's sugar intake.

[Anonymous No.]

>>17697325
tofu, vegetables,fruits, mushrooms shots

[Anonymous No.]

>>17697343
I'm just stating a fact
"mofu" would probably be more like rabbit fur than fox

[Anonymous No.]

>>17697325
Fruits, vegetables, bread or rice if she's Oriental

[Anonymous No.]

>>17697325
Fruits, Slime Jelly, Vegetables, milk, honey, and mushrooms.

[Anonymous No.]

>>17697325
>no other animals exist
Nah, they do.

[Anonymous No.]

Whats your waifus favorite desert?

[Anonymous No.]

>>17697345
I am not talking about the MGE world. Just a hypothetical world in which monster girls replace all animals.

[Anonymous No.]

>>17697368
You sound like you're backtracking.

[Anonymous No.]

>>17697367
Desserts fuck i was distracted.

[Anonymous No.]

>>17696669
Probably remove it.

How do you think a mindflayer react to running into a cybernetic enhanced brain?

[Anonymous No.]

>>17697376
A little disturbed/concerned.

[Anonymous No.]

>>17697367
I imagine it would be her Desert. She would probably like something healthy, like date fruits.

[Anonymous No.]

>>17697367
>>17697376
Pinapple stuff, especially cheesecakes. Goddamn she loves pinapples.

[Anonymous No.]

>>17697376
How about if we are woke asf and she saw our third eye open and staring back at her?

[Anonymous No.]

>>17697367
Baked goods but baklava in particular. I would definitely go full incubus so I could eat all her delicious baked treats and cooking without fattening up.

[Anonymous No.]

>>17697384
My waifu loves it when I use pineapples on her

[Anonymous No.]

>>17697382
Has anybody translated the vodka from those anubis pics?

[Anonymous No.]

>>17697384
>>17697396
>>17697382
Nice, my wife like making fruit filled pastries from the berries she find while wandering around the snow region.

[Anonymous No.]

>>17697397
What. Anon, no!

[Anonymous No.]

>>17697414
But why?

She's a werebat and she loves pinapple. She makes such cute noises while eating it. It's her favorite food!

[Anonymous No.]

>>17697424
That's not using it on her, that's just feeding her. You made me think about things.

>>17697413
I'd buy some snow treats. It would be nice to get them for summer.

[Anonymous No.]

>>17697428
Hm? What kind of things?

[Anonymous No.]

>>17697438
Like throwing pineapples at her.

[Anonymous No.]

>>17697458
Why would you think she likes that?
The only thing I would imagine a girl would like doing with pineapplea is eating them.

[Anonymous No.]

I don't think I can write because my fetishes are literally too degenerate for /mgg/.

[Anonymous No.]

>>17697469
Mhmm...pineapples...
Almost as good as...

Carrots...

[Anonymous No.]

>>17697539
Huff that leg fluff!

[Anonymous No.]

>>17697534
what kind of degenerate fetish are we talking here?

[Anonymous No.]

>>17697428
Well she will trade you some desserts for some fruits from the warmer climates.

[Anonymous No.]

>>17697539
I'd like to slip a carrot between her thighs.

I'd like to slip a jack-o'-lantern between her thighs, too. If you catch my meaning.

[Anonymous No.]

>>17697539
Go back to the shadow! You cannot pass!

[Anonymous No.]

>>17697548
Well, it's not going to be fat or fattening, the thread loves those.

[Anonymous No.]

>>17697571
She might not, but she can already tell that you do.

If you know what I mean.

[Anonymous No.]

>>17697584
Kill yourself. Obesity is a medical condition, not a charm point.

You should support your waifu's efforts to get in shape.

[Anonymous No.]

>>17697605
See this is why these rabbits confuse me. You could literally threaten to rip their souls out and destroy them completely, and they'd somehow take it as a proposal for sex and/or marriage.

How warped can a mind be?

[Anonymous No.]

>>17697376
counter-flayed

[Anonymous No.]

>>17697614
>destroy them completely
Oh my

[Anonymous No.]

>>17697623
See, that's exactly what I'm talking about! You're doing the same thing! Is this a ruse? Am I being baited?

[Anonymous No.]

>>17697610
I was poking fun at the fatfags in this thread, not agreeing with them. And I would exercise with my wife, or in my case, be the prey that she chases for her exercise.

[Anonymous No.]

>>17697628
Poor little Anon
Exploding with rage
Just give in

And explode with something else

[Anonymous No.]

>>17697654
That's not even a proper haiku!

[Anonymous No.]

>>17697654
I want a Cheshire momster who pops in my class when I forget my lunch.
Or when I need help on a test.
And when some girl tries to go after me.
And for some reason I always hear heavy breathing when I'm in the showers.

[Anonymous No.]

>>17697654
No, I like being angry.

[Anonymous No.]

>>17697659
It seems you misunderstand.

That was a shining example of a low-ku

[Anonymous No.]

Raccoon girl when?
No, a Tanuki is not a raccoon. It's a species of fox.

[Anonymous No.]

>>17697669
That cheshire momster needs to act her age! She's not a prank-happy youngster anymore!

[Anonymous No.]

>>17697675
There's no such thing as a 'low-ku!'

[Anonymous No.]

>>17697675
>low-ku
Now I'm imagining a loli Lich asking me for upsies.

[Anonymous No.]

I want to tell my Shog meido not to worry, i'll handle the yard work.

[Anonymous No.]

>>17697682
Acting your age! Yes! Right!

18+

Very good!

[Anonymous No.]

>>17697614
Now, see, the only way to defeat them is to give in. Agree to marry her and have lots of kids, providing intense details about what you two will do together, on the condition that she forces the demon lord to become her servant. Or solves the whole approaching extinction event problem of no sons. Or something similarly difficult. If she can manage that, you'll know she's the one.

[Anonymous No.]

>>17697694
but anon she IS the yard!

[Anonymous No.]

>>17697696
>March Hotaru
I love this. And I love whoever made this.

[Anonymous No.]

>>17697690
And yet you seem awfully convinced of this thing you call a..."high-ku"?

If there is such a thing as a high-ku, there must be a low-ku as well. It's only natural.

Are you sure you're okay?
Not dehydrated, I hope...

Care for some tea?

[Anonymous No.]

What the fuck is happening? Am I having a stroke?

[Anonymous No.]

>>17697709
Stop blog posting asshat.

[Anonymous No.]

>>17697709
Just die you'll feel better.

[Anonymous No.]

>>17697711
What?

[Anonymous No.]

>>17697708
>Care for some tea?
No. I want my loli Lich to give upsies to.

[Anonymous No.]

>>17697709
Drink
The
Tea

Anon

[Anonymous No.]

>>17697718
But if I die, who will play my video games?

[Anonymous No.]

>>17697700
> Shog gardener
Barb plz

[Anonymous No.]

>>17697727
DIBS

[Anonymous No.]

>>17697727
You and your Wispfu can play all the games in the afterlife.
if only that was simple.

[Anonymous No.]

>>17697726
I don't like tea.

[Anonymous No.]

>>17697732
> Shog gardener
Yes please. I would love to work with her.

[Anonymous No.]

>>17697696
What's that's supposed to mean?

[Anonymous No.]

>>17697737
>he doesn't like tea
Found the damn yank.

[Anonymous No.]

>>17697548
Male paralysis through either magic or other bondage. Chaos girls and the like with husband polymorphing. Luminescent cujines.

[Anonymous No.]

>>17697744
Yank's hat, actually.

[Anonymous No.]

>>17697744
Hah, nope. We just don't like shitty British tea. Somehow, on top of all their food being crap, they managed to ruin even tea.

Wonderland tea is superior anyway.

[Anonymous No.]

>>17697740
March hares turn every conversation into something related to sex.

[Anonymous No.]

>>17697747
Victoria is an American?
Explains so much.

[Anonymous No.]

>>17697740
>Acting your age

Imagine what things would be done by someone 18 or older. It's quite obvious.

Care for a demonstration?

[Anonymous No.]

I don't understand what's going on.

[Anonymous No.]

>>17697765
>March Hatter
>Mad Hare
I fucking love the concept, but that face is meh

[Anonymous No.]

>>17697770
Wonderland got all over the thread again and now everyone's gone mad.

[Anonymous No.]

>>17697783
It hurts my head and makes me want to fall asleep.

[Anonymous No.]

Ice Queen-san, please bring the snow and cold weather, it's too hot

[Anonymous No.]

>>17697738
What sorts of plants would you tend together, anon?

[Anonymous No.]

>>17697469
I don't know, anon. Maybe it's because I secretly want to throw pineapples at my waifu and cover her in pineapple juice, mybe lick her up too.

She has scales so it wouldn't hurt her.

[Anonymous No.]

>Just now heard about this
What the fuck? When? How did I not know about this?

[Anonymous No.]

>you will never be breastfed by a holstaurus

[Anonymous No.]

>>17697791
Please don't fall asleep in the middle of Wonderland, you'll wake up covered in Jubjubs.

[Anonymous No.]

>>17697803
But what if that's his plan?

[Anonymous No.]

>>17697791
Sleep...

[Anonymous No.]

>>17697808
It's not, JubJubs creep me out.

[Anonymous No.]

>>17697808
Well then I'd ask what the next step in his master plan is.

[Anonymous No.]

>>17697809
Stop posting Dormice, I'm jealous of how I'll never have sleeps as good as they do.

[Anonymous No.]

>>17697811
Impregnating them.

>>17697810
No need to be modest.

[Anonymous No.]

Good night anons, take care and don't burn down the thread.

Instead, remember that you are always welcome in Wonderland at any time.

[Anonymous No.]

>>17697794
Anything and everything. I'm not talking about regular yard work. I'm talking commercial landscaping here. Mowing lawns, trimming bushes, mulching and maintaining flower beds, seeding and aerating, you name it, I'd love to do it with a Shoggoth.

[Anonymous No.]

>>17697793
I know how you feel, anon. I'd kill to chill in some ice queen titties.

[Anonymous No.]

>>17697818
I don't want to go to Wonderland, It seems like a really annoying place that I'd lose my patience with very often.

[Anonymous No.]

>>17697815
With no survivors?

[Anonymous No.]

>>17697832
Incorrect, there needs to be survivors or else he won't have fluffy little jubjub chicks napping with him on a lazy sunday.

[Anonymous No.]

>>17697815
I'm not being modest, JubJubs genuinely creep me out.

[Anonymous No.]

>>17697838
Anon please, those jubjubs can only take so much hard to get play before they're flooding themselves.

[Anonymous No.]

>>17697842
That sounds like something a Jubjub would say!

[Anonymous No.]

>>17697842
Stop with the jokes, anon.

[Anonymous No.]

>>17697765
Vote?

[Anonymous No.]

>>17697846
Is it?
Is is it the sayings of a man who understands how to get a jub jub's heart?

>>17697849
The only joke here is your denial!
You want the jub jubs, and you want them bad.

[Anonymous No.]

What does a fairy knight protect his titania and her kingdom from? Are people really that evil they will try and attack the fairys?

[Anonymous No.]

>>17697859
I genuinely don't want JubJubs, I don't want any Wonderland girl except for maybe a Cheshire.

[Anonymous No.]

>>17697866
Silly anon, all monsters deserve the fire.

[Anonymous No.]

>>17697866
Fae Knights using toy swords to fend off naughty Pixies who are bullying the poor Fairies!

They just wanted to paint Knight Anon a pretty lewd picture but the Pixies won't stop stealing their craft supplies.

[Anonymous No.]

>>17697821
You may want to consider a Troll for that, my friend. With her lack of grounding in Euclidean geometry you may wind up landscaping someone's yard into something...well, bloody stupid.

[Anonymous No.]

>>17697866
I'm pretty sure the only way to get to the fairy kingdoms is to be invited by a fairy, so they're pretty safe places.

[Anonymous No.]

>>17697878
>>17697881
Darn im trying to write something out about a knight and a titania but i cant find anyone to be the villain. Ok maybe hes so preoccupied with trying to find something to fight in this pacifist land all while the Titania just wants him to take things easy he dosent have to prove himself?

[Anonymous No.]

What's the difference between Fae, Fairy, and Faerie?

[Anonymous No.]

>>17697910
The amount of glitter.

[Anonymous No.]

>>17697910
One of those is also a term for alps

[Anonymous No.]

>>17697798
As usual the Slime is the cutest one.

[Anonymous No.]

>>17697700
Not at first, but even after she's assimilated the entire spooky estate grounds, I'll still go around trimming the hedges, if you get what i'm sayin'

[Anonymous No.]

>>17697906
There are talking animals in the fairy lands, perhaps the titania would have to stop the knight from deciding they are abominations and attacking them?

[Anonymous No.]

>>17697928
Oh, and plants, forgot the plants"

>The docile, adorable, animals and plants can talk like people, just as in a children's storybook.

[Anonymous No.]

[Anonymous No.]

>>17697928
Im thinking about making him his own worst enemy like you say. He keeps trying to find things to fight and he feels he has to protect the Titania and her fairys but that isnt why she brought him her and married him. He is just too stubborn to get that he dosent have to fight anymore and can finally enjoy his quiet life.

[Anonymous No.]

>>17697939
I want to tease her

I want to tease her SO MUCH!!!

[Anonymous No.]

>>17697939
Someone needs a hug...

[Anonymous No.]

>>17697947
Well the kesaran pasaran and their fluff floating around everywhere should mellow him out eventually.

[Anonymous No.]

>>17697939
The cutest tentacle ever!

[Anonymous No.]

>>17697939
My daughteru! In dire need of a head pat!

[Anonymous No.]

>>17696706
Just finished Anonymoose's saga.
When I started out to read stories starting from the top I didn't expect to run into a saga of all things, even if it's not complete yet. Took me a few days and sleepless nights. Was a nice read though.

[Anonymous No.]

>>17697539
Does a dry carrot mean she's satisfied?

[Anonymous No.]

>>17698038
Wouldn't it be the opposite?

[Anonymous No.]

>>17698040
I never assumed so, since they suck on carrots when they're lonely. Then again, I could've been vastly mistaken on that, so I won't rule that one out.

[Anonymous No.]

>>17697793
I want to share an extra long, thick, wooly Cuddling Scarf with an Ice Queen and make her blush

[Anonymous No.]

>>17697888
To you, maybe. We would make sure to cultivate a rather... distinct clientele. A budding landscaping business with a specialty in curved space would certainly be of interest to many. With enough hard work, it could bloom into a wonderful opportunity for others like us.

[Anonymous No.]

Ready for the space elves invasion anon?

[Anonymous No.]

>>17698085
Only if I get to fight using mining equipment.

[Anonymous No.]

>>17698085
>being invaded by a race of sluts
Oooooh noooo, I'm sooooo scared

[Anonymous No.]

>>17698085
I'd rather stick to the wilderness.

[Anonymous No.]

>>17698085
What do they do with male prisoners?

[Anonymous No.]

>>17697748
>Hating britbong tea

[Anonymous No.]

>>17698085
I, for one, welcome our new elven slaves.

[Anonymous No.]

>>17698115
They are taken as spoils of war and forced to marriage,must produce at least five daugherus

[Anonymous No.]

A couple new wife commissions finished today.
this one

and also this one (came with a little bonus)
http://imgur.com/a/Dxhfs

[Anonymous No.]

you will never be fed by a monstergirl

[Anonymous No.]

>>17698085
As long as they aren't the dark kind of space elves. Those are a bit too kinky for me. I prefer pic related.

[Anonymous No.]

>>17698134
Cute!

[Anonymous No.]

>>17698085
>spikes on armor
What an edgy little child. Everybody point and laugh at her grossly ineffective choice in defense.

[Anonymous No.]

>>17698168
Being fed with multiple limbs is cheating
I don't know if I want this

[Anonymous No.]

>>17698168
Worst moth.

[Anonymous No.]

>>17698085

[Anonymous No.]

>>17697888
Correct me if I’m wrong, but doesn’t non-Euclidean just mean, not on a flat surface? Spheres and cylinders are already non Euclidean and we have no trouble realizing that three 90 degree angles can make a equilateral triangle.

[Anonymous No.]

>>17698181
>feeding
>hand holding
>head patting
>mouth wiping
all at the same time,
its just more efficient.

[Anonymous No.]

>>17698187
Pretty much.

Lovecraft was a hack every now and again

[Anonymous No.]

>>17698116
Hi Beast.

[Anonymous No.]

>>17698187
>but doesn’t non-Euclidean just mean, not on a flat surface?
yeah but there are other geometries that are just plane weird,
take the geometry of the event horizon of a black hole, where there literally does not exist any other direction but toward the singularity.
like its not an issue of being able to exert enough force to counteracts the gravity to go back, the concept of "back" no longer exists.

[Anonymous No.]

>>17698187
The point is mostly that the average person would disoriented if they were just popped into space where those rules held true. We're not really made to perceive general 3D space like that

[Anonymous No.]

>>17698204
Isn't there some form of radiation or something like that that is speculated to escape from black holes?

[Anonymous No.]

>>17698187
The key take-away is that said triangle is also, per definition of a polygon, composed of perfectly straight lines.

[Anonymous No.]

>>17698217
Somewhat. Normally when certain sub-atomic particles form in space, they form in pairs that instantly obliterate each other. When these pairs form at the event horizon of a black hole, one of the two is sucked in, and the other is free to fly off. This is the super basic explanation of Hawking radiation.

[Anonymous No.]

>>17698217
hawking radiation, its actually not coming from the inside of the even horizon, but from a phenomenon that occurs at the edge of it when it interacts with space,
see space has a peculiar property where virtual particles pop in and out of existence at every instant, they occur in pairs and annihilate each other,
when this happens right at the edge of the event horizon, one of the particle gets sucked into the event horizon, and the other turns into a real particle and escapes as radiation.

[Anonymous No.]

Which is better, Zipangan cuisine, or Mist Continent cuisine?

[Anonymous No.]

>>17698227
Mist cuisine.

Uncooked fish is poison

[Anonymous No.]

>>17698208
Would it be like if we were dropped onto a planet like in Mario Galaxy or the little prince?

[Anonymous No.]

>>17698231
What about authentic Nureonago made mochi? They’re amazing at getting the right texture.

[Anonymous No.]

>>17698257
I wouldn't be qualified to say, but I imagine your brain would interpret it as the space you are in having a curving differently at each point in said space.
This is based on the main axiom of Euclidean space being that the shortest distance between two points is a straight line. So non-Euclidean space would not have this property. Therefore, when travelling between point A and point B, your brain would assume that you are going in a straight line, when in fact you are not.

[Anonymous No.]

>>17697367
Ice cream. Though she has to eat it really fast.

[Anonymous No.]

>>17698257
Motion sickness in record time.

[Anonymous No.]

>>17698257
Mate, Earth's surface is non-Euclidean. It's just that Earth is so large compared to us that we can approximate the area immediately around us as being flat.

[Anonymous No.]

I dont have an image so what if.
What if bitter CC elemental titans?

[Anonymous No.]

Every Dragon has it's treasure.

[Anonymous No.]

>>17698285
Yea, for sure. We don't exist within the surface of the earth, though. When people refer to non-Euclidean geometry, they're talking about the actual space we exist in being curved, not just the surface we rest on.

[Anonymous No.]

>>17698288
>that Spoiler

go on

[Anonymous No.]

>>17698295
Happy happy, work away~

[Anonymous No.]

>>17698288
I would have to say yes. Big wave waifu for me please.

[Anonymous No.]

>>17698288
Y bitter tho?

[Anonymous No.]

>>17698295
Pocket Dragons are great for finding all that loose change.

[Anonymous No.]

>>17698295
I hope pocket dragon is happy.
I want to make her happy.

[Anonymous No.]

>>17698321
How would she react if I gave her one of those automatic counting coin banks for her birthday?

[Anonymous No.]

>>17698325
High pitched skrees, in a good way, and her frantically nuzzling against your finger licking it happily. Then she'd go about setting up a 'fortress' around it that she'd guard from all the other pocket sized monstergirls.

[Anonymous No.]

>>17698333
>Pocket P'Orcs keep trying to raid it.
>End up getting their rumps sizzled, forcing them to retreat.
>Smell of bacon starts to fill the room.

[Anonymous No.]

>>17698339
Mere pocket P'Orcs are no match for the menacing matriarch of Cling-Cling mountain!
She's a bit feral but it makes her all the fiercer!
At night she'll look up at the moon shining through the window and wish she could be big enough to make you her treasure.

[Anonymous No.]

What would it be like to use a POV shift potion while making love to a fairy or other pocket monster? Who would enjoy it more, her getting to experience being big or you getting to experience being tiny.

[Anonymous No.]

>>17698321
I'm reminded of something a long time ago about pocket Tanukis and Anubi. There was one scenario I quite liked where anon was at a food establishment, and the two argued about whether he should get the monetarily efficient choice or the healthier choice.
Then a pocket kikimora appeared with an ice cream coupon or something along those lines.

[Anonymous No.]

>>17698339
Careful. A well guarded hoard might attract a pocket Mimic.

[Anonymous No.]

>>17698365
Is a Pocket Mimic disguised as a wallet? Or maybe car keys?

[Anonymous No.]

>>17698374
maybe even more devious things, like a zippo or switchblade. I'd like to see a delinquent Mimic in switchblade form, who you could use to comb your hair in stylish ways

[Anonymous No.]

>>17698365
>>17698374
>Pocket mimic disguised as an onahole

[Anonymous No.]

>>17698385
What a devious way to trick a Human into impregnating you.

[Anonymous No.]

>>17698385
At-least she gets her daily vitamin-M. Imagine having to sandwich your dick in a wallet to bang your mimic girlfriend.

[Anonymous No.]

>In the first century, after the Day of Thunder ended the First War, the Kami Hida was despondent. His wife had died in the war and their only son, Hida Atarasi, had never returned from the battle with Fu Leng. Hida still led his clan, but he did so alone, mourning his loss. His suffering touched the heart of the Thunder Dragon, and one night Hida returned to his quarters to find a beautiful woman standing in the room’s open window, her hair whirled around her by the wind. “I am the Dragon of Thunder,” she told him, “and I love you.” Nine months later, she returned to Hida and handed him his son, Osano-Wo, the man destined to lead the Crab Clan against the trolls and who would eventually become the Fortune of Thunder.
>ywn impregnate a Dragon deity

[Anonymous No.]

>>17698403
THE LORE RUNS DEEP

[Anonymous No.]

Aaaahhhh!

I wanna fuck a beetle!

[Anonymous No.]

>>17698419
I wish Latenight would draw a Soldier Beetle dancing to: https://www.youtube.com/watch?v=pIgZ7gMze7A

[Anonymous No.]

>>17698227
What kind of advice/fortunes are printed on monster girl fortune cookies?

[Anonymous No.]

>>17698436
>A blonde from afar has something interesting for you
>great fortune will come your way if you hang in there
>you may win a contest

[Anonymous No.]

>>17698422
>Anon trying to stifle his laughter after finding a Soldier Beetle dancing to Wham!
Sounds pretty cute. Could even be a prelude to pic related.

[Anonymous No.]

>>17698422
Don't they live in forests? How would they be able to play music?

[Anonymous No.]

Regura should not be allowed to colour things, I nearly had a heart attack.

[Anonymous No.]

>the first time you meet your waifu she's standing outside your window blasting a song at you with a boonbox
What is the song she is playing, and what else might she do for added effect on the first time you see her?

[Anonymous No.]

>>17698527
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII LOOOOOOOOOOOOOOOOOOOOOOOOOOOVE YOOOOOOOOOOOOOOOOOU JESUUUUUUUUUUUUUUUUUUUUUUUUUUUS CHRIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIST

[Anonymous No.]

Poor little horror spiders

[Anonymous No.]

>>17698523
>this image
https://www.youtube.com/watch?v=7N-huLe2MKQ

[Anonymous No.]

>>17698534
This is garbage.

[Anonymous No.]

>>17698539
Garbage [remastered]

[Anonymous No.]

>>17698543
Are you fucking blind? Look at the image again you nerd.

[Anonymous No.]

Tell me, late-night anons: Who is your favorite and least favorite girl, and why?
Now what would happen if you magically synthesized the two? Are the bad traits made bearable for you? Or as the good traits simply ruined?

[Anonymous No.]

Momotaro can't catch a break.

[Anonymous No.]

>>17698534
This makes me sad.

>>17698543
It's still bad.
I don't think it can be salvaged.

[Anonymous No.]

>>17698527
https://www.youtube.com/watch?v=JzEs8kYIZ6Y

That one, but on an occasion that special she'd probably be singing it herself. She'd only do it in the middle of the night though, for the added suspense and so there's less of a chance of anyone seeing her singing.

[Anonymous No.]

>>17698548
Momotaro marriage doujins are always good.

[Anonymous No.]

>>17698527
https://m.youtube.com/watch?v=9GbJ33EuL_o

[Anonymous No.]

Don"t let your loli get pleasure runes, it will ruin her innocence forever.

[Anonymous No.]

>tfw you will never invite the Hellhound next door to your barbecue
>tfw you will never go inside and get drunk while watching movies
>tfw she will pull you closer and cuddle with you
>tfw she will never push you down and begin riding you
>tfw you won't wake up the next morning with your head resting in her soft chest fluff and her soft paws caressing your back

[Anonymous No.]

More memes, this time with daughteru.

[Anonymous No.]

[Anonymous No.]

>>17698644
KDF/10

[Anonymous No.]

>>17698644
>daughteru
>gf
Pick one and only one.

[Anonymous No.]

>>17698656
Why though? The two aren't necessarily mutually exclusive with monstergirls anon.

[Anonymous No.]

>>17698656
Get a load of this fag

[Anonymous No.]

>>17698658
>>17698663
.t Pedofags in denial

[Anonymous No.]

>>17698608
The more likely scenario is that she rapes you while enjoying the grilled meat.
If she was a bit more restrained she could try to seduce you for a bit before assaulting you.

[Anonymous No.]

>>17698658
You can have a daughteru, and you can have a gf. But your daughteru can't be your gf, it's degenerate and sad. You're cucking your waifu. You deny your daughteru a normal childhood and life. Let her find a boy her age, and let her have a normal life. Don't disrespect your waifu by taking another.

It'd be no different than having a son, and your son becomes her second husband.

[Anonymous No.]

>>17698669
>Don't disrespect your waifu by taking another.
Anon I think I've made it very clear that my waifu would be just as into the daughteru stuff as I am.

[Anonymous No.]

>>17698669
I don't know how many times we've told KDF this but I don't think it's ever going to work.

[Anonymous No.]

>>17698454
Pic-related is a Jitterbug without even realizing it.

[Anonymous No.]

>>17698644
Sasuga KDF

[Anonymous No.]

>>17698705
You are mistaken. There is only one jitterbug.

[Anonymous No.]

>>17698668
There's always one guy...

[Anonymous No.]

>>17698668
>Enjoying barbecue with hellhound
>She notices you have some barbecue sauce on your cheek
>Points it out to you
>You end up making more of a mess
>She says she'll get it
>Moves in very close
>Starts licking it off your cheek
>Her tongue finds its way to your lips
>Starts licking around them
>Says you taste good
>Sloppy makeouts commence
>She then shreds your clothes and destroys your pelvis right there in your backyard

[Anonymous No.]

>>17697798
where is it?
i cant find it
don't leave me erect pls

[Anonymous No.]

>be adopted by Minamoto Ochi
>believes you are destined to be a great lord with a line of strong heirs
>whenever a girl becomes interested in you, she fights her to see if they are strong enough to be your wife
>not even a dragon has won against her
>you begin to wonder if you'll ever get a wife like this and think you should just ask your Ochi to marry you since she's the strongest you know
>...nah, she's your momster. she'd never agree to that

[Anonymous No.]

>>17698751
So what happens when she gets it in her head that she's the only one strong enough for you and starts secretly preparing your dick for her absurdly high quality pussy by sucking you off in your sleep?
Keep in mind, her body is tempered by literal centuries of battle and she's never had a man before. If you're not prepared it'll feel tight enough to squeeze your dick off.

[Anonymous No.]

Can anybody please give me a link to the new wiki? Maybe I'm just retarded but I can't seem to find it.

[Anonymous No.]

>>17698790
There is a new wiki?

[Anonymous No.]

>>17698744
>Wake me up!
>Before you 'blow blow'!

[Anonymous No.]

>>17698790
>>17698798
mgewiki.com

[Anonymous No.]

>>17698802
Thanks. Shit, there is a discord now..

[Anonymous No.]

>>17698746
Feeding a Hellhound (or any canine species for that matter) is one of the best way to get her to like you.
I wonder how long she will be able to properly enjoy her meal before jumping you because of how tasty you look.

[Anonymous No.]

>>17698749
Tentacle Games. Art by Sayori.
It's an idle game

[Anonymous No.]

>>17698751
>She is extremely strict on anything sex related
>Won't let you masturbate because as to not waste your seed
>Destroys any pornography she comes across
>Constantly reminds you that should find a wife to impregnate ASAP
>Insists on bathing with you everyday to wash your back
>Sleeps in the nude with her door open

[Anonymous No.]

No scans of this yet?

[Anonymous No.]

Vampires love bullying their own sisters

[Anonymous No.]

>>17698845
Scan this

https://www.youtube.com/watch?v=Fvh32fQ8nNI

[Anonymous No.]

>>17698845
It's a text story, not a doujin.

[Anonymous No.]

>>17698851
These are the Shadowverse vampires?

[Anonymous No.]

>>17698863
t. doesn't know what doujin means

[Anonymous No.]

>>17698894
>see filename
Nevermind

[Anonymous No.]

>>17698851
I want to pump that vampire with enough semen to make her far sexier than her sisters

[Anonymous No.]

>>17698897
What impact would all the sisterly bullying have on her personality?
Would she be insecure and needy because of it?

[Anonymous No.]

>>17698897
She already is.

[Anonymous No.]

>>17698321
What a coincidence, there happens to be a self help book for just that!

[Anonymous No.]

>>17698954
Pocket Dragons are not for stretching.
They are for feeding small gems.

[Anonymous No.]

I want a scheming girl with an honest body.

[Anonymous No.]

>>17699004
Then she can suck on the family jewels.

[Anonymous No.]

>>17699048
What about a Merrow who plans a whole convoluted scenario for you to fall in love with her, but upon confronting you can't help herself masturbating furiously?

[Anonymous No.]

So if there is a cat kingdom, does dog kingdom exist as well? Who is dog god? What are they doing in dog kingdom?

[Anonymous No.]

>>17699122
Why would dogs have a kingdom separated by humans? They simply go wherever humans go, and that's it.

[Anonymous No.]

>>17699083
>Pocket Dragon is hungry and ask for a gem
>You pull out your family jewels
>She stuffs her mouth full with one
>Suckles on it for a while
It would either be weirdly enjoyable or plain funny.

>>17699122
Cats are narcissistic assholes. That's why they need their own kingdom.
Dogs are much more humble and share their land.

[Anonymous No.]

>>17699048

[Anonymous No.]

>>17699122
>Hellhound friend has a little bone carving of a shi tzu with a big dopey smile
>Save for the fact it's made from bone it's uncharacteristically her
>That time she "invited" you over for thanksgiving, her mother's house had one too
>Now that you think about it, you werewolf teacher in highschool had one on her desk
>Ask around, apparently lots of dog type beast girls have one
>Bring it up with friend while playing vidya, she explains it's an icon of dog god
>Laugh about how dog god is portrayed as something as unassuming as a shi tzu
>Your friend looks at you disappointed but focuses her attention back on the TV
>Door bell rings, you get up to answer while your friend digs into the cooler for another drink
>Open the door
>It's some sort of extra fluff washboard chest ultra loli kobold... in the nude, you assume she's a sabbath scout
>Explain you don't want the damn cookies and ask where her uniform is
>She says you got it wrong
>Introduces herself as "The goodest girl" and heard you was talking shit like she wouldn't hear it
>Hear bottle breaking on the floor behind you
>Your hellhound has dropped her beer and is now prone on the floor praying at the kobold
>Put two and two together and break out in a cold sweat
>The kobold's smugness intensifies

[Anonymous No.]

>>17698299
Just like the elementals but they are made of natural disasters. Tornados, magma, sub zero-tier ice.
>>17698309
Being locked away by the chief god in tartarus for years they never had a relationship.

[Anonymous No.]

>>17699176
Don't trust grape snakes.
Don't go near grape snakes.

[Anonymous No.]

>>17699184
I can't hel0 the little carving as looking like the annoying dog from undertale

[Anonymous No.]

>>17699184
I can't help but imagine the carving as the annoying dog from undertale.

[Anonymous No.]

>>17698203
Who the fuck is beast?

[Anonymous No.]

Overlord > Demon Lord
Chief God > Omnipotent
Mana > mamono mana
Essence > Spirit energy
Sabbath > Sabath
Renamed species > Old names
The SS translation is better than the fan one for the most part, we should use their terminology.

[Anonymous No.]

>>17699306
Go away seven seas. Maou is literally demon lord.

[Anonymous No.]

>>17699306
>Renamed species > Old names
Like what? Besides Red Oni/Blue Oni being more weeb, and Sahugin being a not!copyrighted name

[Anonymous No.]

>>17698102
bugfucker detected

[Anonymous No.]

>>17699306
>Overlord > Demon Lord
When i see Overlord i can only thing of OPERATION OVERLORD. Also Demon Lord is a better description, she is literally the Lord of all demons in MGE.
>Chief God > Omnipotent
Its been that way for a while now... Much longer since the SS translation.
>Mana > mamono mana
Sabbath > Sabath
These are legitimately the same thing.

[Anonymous No.]

>>17699321
But Demon is a species rather than an encompassing name in English.

>>17699336
Karasu-Tengu too.
The new names are more consistent.

[Anonymous No.]

>>17699306
>Mana > mamono mana

These are two very different things dipshit

[Anonymous No.]

>>17698669
All of those complaints are fixed if she's adopted.

[Anonymous No.]

>>17698184
Space Paladin-chans are the cutest! I want to corrupt one into becoming my waifu without violence or coercion!

[Anonymous No.]

>>17699368
Or if her mother raped you, plopped her out and abandoned the two of you, and she's grown up to be such a good girl that she wants to heal you after what her horrible mother did to you.

[Anonymous No.]

>>17699342
There is literally nothing wrong with being a bugfucker.

[Anonymous No.]

>>17699364
Demon lord still fits better as the name of the leader of Monsters. Whenever I hear overlord I think of a King like Ashnard. Mamono Lord is retarded since unless all other previous rulers were monster girls the name only applies to the current one.

[Anonymous No.]

>>17699374
Sisters of battle almost make it worth being shoved into a meat grinder.

[Anonymous No.]

>>17699364
The new names are dumb. The older ones were much more fitting.

[Anonymous No.]

>>17699403
But you'll never even get a hug from one if you stay loyal. If anything, they're a compelling reason to go traitor.

[Anonymous No.]

>>17699395
Fair point. Though I still think if can lead to confusions.

>>17699404
Seems weird to translate some Zipangu species names and not others.

[Anonymous No.]

>>17699427
I'm onto you slaneesh.

[Anonymous No.]

>>17699393
The wrongness of being a bugfucker varies wildly depending on what bug it is that you have having intercourse with.
A MGE bug is barely wrong.
A Regura bug is wrong but understandable.
That one crazy moth is strictly wrong.
A MGQ bug is extremely wrong.

[Anonymous No.]

who cares, kemono friends is dead...

[Anonymous No.]

>>17699447
Just think about it. That silky smooth hair, don't you just want to sniff it? Fill your lungs with her purity? I bet you do. You want to hug her, huff her, kiss her, maybe even do something lewd with her. Take that suffocating power armor off her slender, fit body and wrap your arms around her, embrace her, enter her, and fill her consciousness with your love.

What if you could hug her even better? You could apply pressure more evenly if you had more arms, or even tentacles. You could hug her much harder without hurting her. How about kissing her lips, her cheek, her forehead and even the tip of her nose at the same time? It would all be so much better if you had mutations. You could enjoy her with every sense, far more than you could as a human. How about admiring her cute butt with echolocation even as it descended towards your face? Watching her ragged breath fog in the cool air with IR vision as your seed slowly spread inside her? There are so many possibilities, anon! All of them can be yours!

[Anonymous No.]

>>17699306
I will never call her overlord since it makes me think of the game overlord.

[Anonymous No.]

>>17699489
I don't even know why this turns me on.

Fucking god damn chaos gods.

[Anonymous No.]

>>17699457
Some MGQ bugs are good, the bee queen is great.

[Anonymous No.]

>>17699517
There's nothing more pure than an Abomination in love. You could even become a writhing mass of flesh, welling around her, whispering in her ear with a dozen voices about how much you love her, how much you always loved her. You could hug her entire body at the same time, rub your cheek against hers while kissing her feet simultaneously. You could even share the air that you breathe, filtering the air, warming it so it was perfectly comfortable for her delicate lungs.

You could spend every night wrapped around her, coddling her, worshipping her, and awaken in the morning to the sight of your beloved's face. Pull yourself into a human form and hold hands with her outside on a nice walk, only to collapse into a pile of primal essence the moment the door closed behind you two. Maybe going outside could be a form of teasing play, spending time apart so that it would feel even better to finally wrap yourself around her and fill her cavities with your lustful flesh.

[Anonymous No.]

>>17699564
I think I know how shoggoths think. Almost.

[Anonymous No.]

>>17699569
There's something even better than touching your beloved. It's being touched by her. Imagine concentrating your entire being into a ball, pressed between her modest bust, her delicate hands, and her lovely face. What a human could only experience with his head, you could feel with your entire body. Her soft, gentle touch, her snow-white hair caressing your surface, the exquisite agony of being entirely at her mercy.

You would slowly withdraw from around her, finally leaving her naked, kneeling on the bed with you in her arms. With every wave of essence that flowed together, the sensation of her love would grow more potent, until you couldn't even hold yourself together anymore. You'd flow down her chest, then her abdomen, and finally all over her thighs in absolute bliss. I'm sure having you melt into a puddle of ahegao'd goo in her embrace would warm her heart.

[Anonymous No.]

>>17699457
>A Regura bug is wrong
This statement is wrong.

[Anonymous No.]

>>17698644
Alright. I’ll bite.
Is Paris an euphemism or are you actually Parisian?

[Anonymous No.]

>>17699457
How wrong is this bug?

[Anonymous No.]

>>17699612
0% wrong.

[Anonymous No.]

>>17699457
>A Regura bug is wrong
>That one crazy moth is strictly wrong
I don't want to live in the same planet than you

[Anonymous No.]

>>17699612
Which one?

[Anonymous No.]

>>17699593
Stop making chaos faction seem so damn good.

[Anonymous No.]

>>17699652
No.

Chaos girls are the best. It's why I write about them so much.

[Anonymous No.]

Kemono friends is dead...

[Anonymous No.]

>>17699602
I hate all manner of insects, but Regura makes me wanna fug a bug.

[Anonymous No.]

>>17699457
/y/ is a few blocks down.

[Anonymous No.]

>>17699361
KC has outright said he considers "demon lord" misleading as the position has been held by a number of monster types besides demons. Its why Monster Girl Redux has used Mamono Lord for so long, and presumably why Seven Seas went with Overlord.

[Anonymous No.]

>>17699670
Just apply necromancy to the affected areas.

[Anonymous No.]

>>17699431
>Seems weird to translate some Zipangu species names and not others.

I think it depends on how familiar the name already is in english. Even in Seven Seas version they note that the aka and ao onis are also called red and blue onis.

[Anonymous No.]

>>17699681
But "Demon Lord" is the translation for that sort of stuff in general.

[Anonymous No.]

>>17699685
>zombie shoebill
This is a hot thought.

[Anonymous No.]

>>17699685
It's better to left them dead than to turn them into undead shit.

[Anonymous No.]

>>17699681
KC only said that to the EOP fanbase because they kept seeing "demon lord" and letting it inspire their HFY instincts to fight evil. He still uses the japanese name for demon lord in the raws and the nip fanbase uses it as such.

"Mamono lord" is essentially using a bastardized 4kids version of it.

[Anonymous No.]

No one here has an Ogre waifu?

[Anonymous No.]

>>17699691
Its one translation, but not the only one. And at times a literal translation can be a misleading one.

>>17699699
But "mamono" is the term KC likes linked to his monsters. MGR outright asked what term should be used and were given "mamono lord" as an option.

[Anonymous No.]

>>17699706
Somebody just told me

[Anonymous No.]

>>17699709
>But "mamono" is the term KC likes linked to his monsters
For general monsters yes, not for the demon lord though.
> MGR outright asked what term should be used and were given "mamono lord" as an option.
Because he sees the english fanbase as irresponsible children and he's not wrong if you look at MGU/MGR/the wiki.

[Anonymous No.]

>>17699706
I dpn't think so.

[Anonymous No.]

>>17699699
For reference, here's what Exet_mos (an associate of KC who has done most of his talk with the english fanbase) said regarding the name and its meaning:

>"Demon Lord" or "魔王(Maou)" is also difficult term to translate.　Originally, it is terms of the Buddhism for lord of "天魔(Tenma)", which means demons.　But in JRPG, the word means rather "lord of monsters", and they are not always demons.　Sometimes a dragon or a beast-man can be "魔王(Maou)".　So I think "Lord of Mamono" or simply "Maou" is more appropriate.

So it seems to be a case of JRPGs using the term differently from its literal meaning, and KC using it in that context. Its no problem for his Japanese fans as they recognize the context, but in English it can cause confusion so he wanted a different name used.

[Anonymous No.]

>>17699681
Seven Seas themselves uses the term "demon lord" as a translation for "maou" in other books.
Also, in Japanese, "maou" is generally used to refer to demon lords such as Belial, Astaroth, Amon, etc. And these demon lords themselves are depicted as different monsters with a wide variety of forms.

Examples of Seven Seas using "demon lord" for "maou":

http://www.sevenseasentertainment.com/series/theres-a-demon-lord-on-the-floor/

http://www.sevenseasentertainment.com/series/how-not-to-summon-a-demon-lord/

http://www.sevenseasentertainment.com/series/if-its-for-my-daughter-id-even-defeat-a-demon-lord/

[Anonymous No.]

>>17699725
Speaking of exet, we still don't have word on that "official translation" for the game do we? The fan translation could have been done three times over by now.

[Anonymous No.]

>>17699306
The Chief God is not omnipotent.....

[Anonymous No.]

>>17699725
It's several-fold language barrier induced stupidity in this case. Some english-speakers don't understand the context of "Demon Lord" that comes from japanese media and take it literally, like the fucking morons in this very thread who argue it's a bad translation because she/previous DLs aren''t Demons. But on the other hand KC and Exet treat it literally too and ignore the existance of context, because they cannot into english and advocate for a shit translation because of that.

[Anonymous No.]

>>17697798
Looks a bit too generic.

[Anonymous No.]

Do lamias pick up a lot of static electricity from slithering around the house?

[Anonymous No.]

>>17699741
>there is a demon lord on the floor
Sounds like what would happen if the DL played twister.

[Anonymous No.]

>>17699769
Not unless she wears that wool tail cover you got her for Christmas. Then her hair stands up from the static like a Medusa's snakes.

[Anonymous No.]

>>17699670
Sadness covers me like blanket
Tuck me in
Let me die

[Anonymous No.]

>>17698385
Is the human aware of this or is this a surprise?
Maybe she can transform into my underwear so she can tease me the whole day.

[Anonymous No.]

Stupid sexy cats

[Anonymous No.]

Shog's are only good for one thing!

[Anonymous No.]

>>17699867
Reminds me of this for some reason

[Anonymous No.]

>>17699867
It is best to limber up properly before marathon sex.

[Anonymous No.]

>>17699871
Detective Kiki will clean out the city of crime!

[Anonymous No.]

>>17699609
correct me if I'm wrong but I think it means eiffel towering.I'm pretty sure KDF is texan anyway.

[Anonymous No.]

>>17699609
Yes, >>17699959 is right on both counts.

[Anonymous No.]

>>17699871
>>17699956
>Shog knows who did it the whole time but can't provide evidence, it's just eldritch knowledge
>genki Kiki has to work backwards from it to prove who the killer is
>Shog acts as a jelly-meatshield in shootout situations
>Kiki often cleans up a crime scene after getting what she needs from it
>thankfully Shog can perfectly recreate the room later to review evidence
The hardest nose detectives on the beat!

[Anonymous No.]

>>17699992
>>genki Kiki has to work backwards from it to prove who the killer is
Does genki kiki detective speak in a rapid fire boston accent?

[Anonymous No.]

>>17700001
Yep. She's from the streets!
And Shog puts on an airy out of town southern accent her true voice is stoic, creepy, and only comes out when she plays the bad cop in interrogation

[Anonymous No.]

No matter how proud, haughty or dominant a wolfu is THIS is her fate.
https://pbs.twimg.com/media/DK1RCybUEAAdqmR.jpg

[Anonymous No.]

>>17700113
MERE BITCH.

[Anonymous No.]

>>17700080
When will they go after the infamous Serial Hugger?

[Anonymous No.]

[Anonymous No.]

>>17700142
Is there a name for those eyebrows that are just circles?

[Anonymous No.]

>>17700147
weird

[Anonymous No.]

>>17700147
I don't know but I can't say I care for them.

[Anonymous No.]

>>17700113
Can't beat the D.

[Anonymous No.]

To all anons here with waifus. How long have you been with her?

[Anonymous No.]

>>17700156
>>17700178
I don’t know if I’ve ever heard of anyone especially liking them. Are there people here that fetishized them?

[Anonymous No.]

>>17700224
Three years and a bit.

[Anonymous No.]

>>17700224
Since 2008.

[Anonymous No.]

>>17700224
Almost 4 years now. I didn't think of her as my waifu when I started writing stories about her, but it eventually turned out that way.

[Anonymous No.]

>>17697382
Why is she so big?
If he stood up he would only go up to her tits.

Speaking of which, what's your favorite size ratio /mgt/? Do you prefer to be the same height as your waifu? Taller? Shorter?
Personally, my head only going up to her shoulders feels like the perfect size difference to me, though I wouldn't mind variance in either direction.

[Anonymous No.]

>>17700224
Funny you should ask anon, tomorrow marks our exact 2 year anniversary.

[Anonymous No.]

>>17700260
Roughly the same size for me, so standing hugs and sex are easy and comfortable.

[Anonymous No.]

>>17700260
Lolis make for the best size difference.

[Anonymous No.]

>>17700260
Same height or maybe just a few inches higher than me. Being the same height makes sex way more loving since you can kiss and fuck at the same time with no problem.

[Anonymous No.]

>>17700260
>If he stood up he would only go up to her tits.

[Anonymous No.]

>>17700260
>Speaking of which, what's your favorite size ratio /mgt/?
I'm a big fan of size differences anon, whether I'm the bigger one or the smaller one. That being said my waifu is just 5 feet tall and about 8 inches shorter than me, I think that sort of size difference is my top favorite. Then there's my daughteru who is a foot shorter than my waifu, because a more extreme size difference with a smaller girl is very nice as well.

My waifu would also take a Dire potion on very rare occasions to make her a nice squishy strongfat. In that form she'd be a foot taller than me at least, so the two of us can experience a lovely reversal of our usual usual height differences. Also, watching my Dire-form waifu pick up and happily cuddle or play with our comparatively diminutive daughteru would be heart melting.

[Anonymous No.]

>>17697382
>tfw you overcooked her food

[Anonymous No.]

>>17700224
Since 2006

[Anonymous No.]

>>17700260
I don't have a waifu but when it comes to my favourites my preferred heights vary a lot
>lich
Shorter than me while slightly above chest height and slightly bellow chin height.
>jinko
Wouldn't settle for anything less than only being up to her tits, big cats are the best cats.
>griffon
Slightly shorter than jinkos but still huge
>satyros and wight
Same size as me, they seem like the perfect girls to walk arm and arm with as physical equals.

[Anonymous No.]

>>17700260
>writing a story with multiple characters and keeping track of heights
This is hell. I am in hell.
>My favorite
The classic: man one head higher than woman.

[Anonymous No.]

Food's ready du-

[Anonymous No.]

>>17700497
fox in socks needs to look where she is going.

[Anonymous No.]

>>17700405
Make a diagram or something. It's what I did to keep track of relative time and people's ages in series that span years.

[Anonymous No.]

>>17700497
Dude what happened?

[Anonymous No.]

https://twitter.com/DaftBonkers/status/913786314293571584

The correct way to love your fox waifu.

[Anonymous No.]

>>17700507
Something you want to befall only on your worst enemies, not your mistress of mofu.

[Anonymous No.]

Would it be considered abuse to refuse giving sex to your Ochi after she returns injured from a fight?

[Anonymous No.]

>>17700606
Of course not. She would never impose her own gutteral desires upon her dear lord. It is her unending duty to protect him and serve him as he sees fit. If he so wishes her to service him in such a way, so be it. She loves her master so and would do anything for him.

[Anonymous No.]

>>17700606
Would putting your dick in her wounds with the excuse of getting the medicine straight to the spot be consideres abuse?

[Anonymous No.]

>>17700646
That's how you heal her though.

[Anonymous No.]

>>17700497
RAN! THE LEGOS!

[Anonymous No.]

>>17700606
she would just think youve been drugged by an assassin and start sucking the poison out

[Anonymous No.]

>>17699457
>Not wanting to fug Regura bugs

[Anonymous No.]

>>17700785
I want to pay to fug this Regura bug!

[Anonymous No.]

>>17700497
RIP

[Anonymous No.]

>>17700822
Now I'm tempted to write down Regura roach girl prostitute into wife as a story idea

[Anonymous No.]

>>17700852
>roach girl prostitute
YES
>into wife
ruined

[Anonymous No.]

>>17700863
I'm assured that prostitution is just blind speed-dating for monstergirls. As in, monstergirl prostitutes marry their first customer.

[Anonymous No.]

>>17700869
Honestly the shitty joke of it on paper is that she'd joke about being lucky if she ever got paid for sex, being a roachfu, only for Anon to oblige because she's cute.

[Anonymous No.]

>>17700785
Regura bugs are so pleasing to look at and i dont even like bug girls too much. I just want to be nice to them and rub their exoskeleton parts.
>tfw no bug waifu who shows off her creeoy big face when she is mad.

[Anonymous No.]

>>17700785
I want a Regura bug momster!

[Anonymous No.]

>>17700869
I'm sure there are people who like it that way, but it's not my fetish. I want my hookerbug to be aloof and detached, you know, texting while giving a handjob, watching TV while taking it prone, that sort of thing. Her doing it just for money is a big part of the attraction of the scenario.

[Anonymous No.]

>>17700889

[Anonymous No.]

>>17700892
Yeah, I can understand your fetish but I'd sooner walk into Hell barefoot than write something like that just to draw the ire of the more vocal people in the thread.

[Anonymous No.]

>>17700822
>compensated dating with a gyaru bug
I want this so much.

[Anonymous No.]

>>17700896
>Mosuraaaa ya, Mosuraaa...

[Anonymous No.]

>>17700224
I'm terrible with the concept of time and dates, but she became my waifu about half a year before these threads got moved here, however long ago that was.

[Anonymous No.]

>>17700946
Fug this bug.

[Anonymous No.]

Do you like this thing?

[Anonymous No.]

>>17699670
Good riddance to bad rubbish

[Anonymous No.]

>>17701057
Mersharks are pretty well-liked, yes.

[Anonymous No.]

>>17701057
get the harpoon

[Anonymous No.]

>>17701067
I'm not touching that shark, she's going to bite me.

[Anonymous No.]

>>17701057
Yes, that thing is cute and I would bop her on the nose.

[Anonymous No.]

>>17701057
>>17701067
They've got to give me a bitejob before I give them headpats.

[Anonymous No.]

>>17701079
Just a love nibble anon.

[Anonymous No.]

>>17701091
Can she start with a nibble before the frenzy?

[Anonymous No.]

>>17701106
One chomp, one pat. If she gets me off with her teeth, I'll pat her until she ahegao's.

[Anonymous No.]

>>17701057
I think I owe her an apology. She tried to do that boombox thing, and she got a bit of a shock.

[Anonymous No.]

>>17701057
Shark are very dangerous!

[Anonymous No.]

>>17701057
I like this thing so much I wrote a story about her.
>tfw no exosuit to wear underwater that lets you keep up with her.

[Anonymous No.]

>>17699670
I was having a nice day, why you needed to ruin it?

[Anonymous No.]

>>17701165
i mean if you are one of those kf people shouldn't you been depressed all week?

[Anonymous No.]

RIP smug Raccoon

[Anonymous No.]

>>17701194
Kemono Friends is garbage, I'm glad it's gone.

[Anonymous No.]

>>17701194
>>17701202
I thought that show was super popular?

Did it die? I bet that bear hand doujin was responsible.

[Anonymous No.]

>>17701194
They live on in our hearts.

[Anonymous No.]

We need more alien waifus.

[Anonymous No.]

>>17701213
The production company fired the director, tore up the animation studio's contract and released several of the voice actresses because they had previously handed the franchise over and told them they could do whatever they wanted with it, then desired total control once it blew up into the next big thing.

[Anonymous No.]

>>17701194
>>17701223
The quad-ears shit was the worst.

[Anonymous No.]

>>17701232
Cute space abomination.

[Anonymous No.]

>>17701232
I liked the manga "oh my sweet alien " it was basically what I wished monster musume would have been.

[Anonymous No.]

[Anonymous No.]

>>17701260
>we will never see more of this wonderful piece of art
This world is so cruel.

[Anonymous No.]

>>17701339

MG dating sites would be quite something.

And pop ups for them would be everywhere.

[Anonymous No.]

>>17701339
That's a hard left.

[Anonymous No.]

>>17701260
RIP

[Anonymous No.]

[Anonymous No.]

>>17701339
Would swipe right, she's a slut but my kind of slut.

[Anonymous No.]

>>17701380
>Slut
Thotties get the shotty

[Anonymous No.]

>>17701339
>casual encounters
Never.

[Anonymous No.]

>>17701383
>Thot
Please keep that shit in twitter.

[Anonymous No.]

>>17701377
Best Dragon loli

[Anonymous No.]

>>17701405
Humans with no dragon features are my favorite dragons.

[Anonymous No.]

>>17701405
That's not freddy.

[Anonymous No.]

I want a nerdy bug to cosplay and pretend to be a slutty gyaru and try to offer me sex for money with a quivering voice.

[Anonymous No.]

>>17701159
Post it then.

[Anonymous No.]

>>17701418
She's not a loli.

[Anonymous No.]

>>17701421
you forgot your exclamation mark.

[Anonymous No.]

>>17701424
She can be, that's the beauty of freddy, she can be whatever you want.

[Anonymous No.]

>>17701441
She can be a legal loli, but she's not a real one.

[Anonymous No.]

>>17701449
But that's the best kind of loli.

[Anonymous No.]

>>17701339
Rejected

[Anonymous No.]

>>17701459
That is correct.

[Anonymous No.]

>>17701460
Poor sneks. Give them a break, they just want love.

[Anonymous No.]

>>17701460

I'd play a Papers Please but with monster girls

[Anonymous No.]

What are the best waifus in games the ones that want to kill you
>qt lamia dullahan
>girtabilu
ds2 had some good ones

[Anonymous No.]

>>17701339
>casual milf sex
I'm sorry, my purity, but that's just way too much.

[Anonymous No.]

My waifu can beat your waifu!

[Anonymous No.]

>>17701498
My waifu is a cool and strong dragon. She can beat a lot of waifus and my daughteru can even beat the low ranking ones!

[Anonymous No.]

>>17701460
>Cobrastan is not a real country.

[Anonymous No.]

>>17701384
Never trust a monster girl who proposes casual sex with no aftermath.
She will always kidnap and forcefully marry you unless something goes awfully wrong.

[Anonymous No.]

>>17700132
Never! My waifu and I are safely out of their jurisdiction! They can't touch us!

[Anonymous No.]

>>17701459
The genuine ones are superior.

[Anonymous No.]

Sneks good?

[Anonymous No.]

>>17700224
My first waifu was in 1997 and the latest member of my harem was two years ago. She's a Nuraihyon. And my first waifu can technically count as a "monstergirl" too.
I forgot; do aliens count as MGs?

[Anonymous No.]

>>17701498
682 is the strongest lizard!

[Anonymous No.]

>>17701551
Detective Kiki's a loose cannon! She'll bring you to justice even if the law says she can't!

[Anonymous No.]

>>17701339
Left. Slut.

[Anonymous No.]

>>17701571
EMG sneks aren't.

[Anonymous No.]

>>17701609
>filename
Why are yandere girls the absolute best?

[Anonymous No.]

>>17701571
Miia's a good girl.

[Anonymous No.]

>>17701580
You're out of line, Kiki!
The mayor's all over my ass these days, so either get your act together or I'll have your badge!

[Anonymous No.]

>>17701573
>My first waifu was in 1997 and the latest member of my harem was two years ago.
STOPPU

MORE THAN ONE WAIFU CAN END YOUR LAIFU

[Anonymous No.]

>>17701625
I have pretty high standards for a waifu and I've only had four more waifus since 1997.

[Anonymous No.]

>>17701339
isnt her whole thing is that she wants to kidnap a man and drag him to her village

[Anonymous No.]

>>17701551
Only beat cops Shog and Kiki and take down the insane Serial Hugger, they don't play by the rules

[Anonymous No.]

>>17701640
I'm pretty sure group snex is supposed to be that, reverse gangbang.

[Anonymous No.]

>>17701639
The girls may be up to your standards, but polygamy isn't up to their standards.

[Anonymous No.]

>>17701616
She probably says that while biting you.

[Anonymous No.]

>>17701640
Don't go around disrespecting her culture!

[Anonymous No.]

>>17699706
OH HELLO THERE

[Anonymous No.]

>>17701651
>group snex
Hello new band name.

[Anonymous No.]

>>17699706
Lmao you're tall and no one will love you besides masochists and fetishists.

[Anonymous No.]

>>17701639
>I have pretty high standards for a waifu
Obviously not.

[Anonymous No.]

>>17701624
Then she's gonna have to go completely rogue! And she's taking Shog with her!

[Anonymous No.]

>>17701774
Now I’m imagining the Kiki taking her shog partner up under her arm and walking out while the shog sticks her tongue out.

[Anonymous No.]

Don't overwater the plants

[Anonymous No.]

>>17701806
So overinseminate them?

[Anonymous No.]

>>17701806
Fatass anime tiddies.

[Anonymous No.]

>>17701806
I'll cum a lot in them.

[Anonymous No.]

>>17701813
The best

[Anonymous No.]

>>17701806
Are those gloves, or are they part of her? What would happen if I started to peel them from the top?

[Anonymous No.]

>>17701806
Rose Alraunes are 100% Ara ara

[Anonymous No.]

>>17701835
It would be extremely arousing.

[Anonymous No.]

>>17701848

She's a big girl

[Anonymous No.]

>>17701848
I’m a dense guy.

[Anonymous No.]

>>17701422
https://pastebin.com/XAtVmcLg
Coincidentally it was my first story I wrote.

[Anonymous No.]

>>17700224
Maybe around three years or so.

[Anonymous No.]

I still want a Lilim, Baphomet, Dragon, and Pharaoh Onee san to dom me til I cry. Damn my writers block.

[Anonymous No.]

>>17700224
pretty close to 2 years or so

[Anonymous No.]

>>17701878
How hard dom are we talking?

[Anonymous No.]

What monster girl is best for comforting me over the death of a fictional character?

[Anonymous No.]

>>17701878
I want a cute Lim

[Anonymous No.]

>>17701885
Yupiel type but slightly more tender, and with more cuddle sex afterwards. Intimidation/Showing absolute ownership over me is a must though.

[Anonymous No.]

>>17701878
I want a teenage baphomet

[Anonymous No.]

>>17701887

your waifu

[Anonymous No.]

>>17701887
Unironically your waifu, I think it fits the situation.

[Anonymous No.]

>>17701899
>>17701900
You know it'd be fun to play video games with my waifu.

[Anonymous No.]

It's no use!
I'm going mad over fluffy rabbits. My heads been soft and pink like cotten candy all day long.

[Anonymous No.]

>>17701903
I was trying to make a joke, you know because fictional characters? Anyone?

[Anonymous No.]

>>17701907
Sorry I'm too fatigued to laugh.

[Anonymous No.]

>>17701907
Try again next time.

[Anonymous No.]

>>17701909
>>17701912
Someday I'll be funny and I will be worth something.

[Anonymous No.]

>>17701915
ganbatte

[Anonymous No.]

If you’re living with an undersea monster girl, you get to breath water because of the Sea Bishop imparting Neptune’s blessing right? What happens during your everyday life though? Does your skin still get pruny? Do you walk like a free diver or do you swim everywhere?

[Anonymous No.]

>>17701906
Cut off her foot for good luck

[Anonymous No.]

>>17701920
Yes.
Whatever you want to happen.
No.
Whichever you want.

[Anonymous No.]

>>17701920
>you get to breath water because of the Sea Bishop imparting Neptune’s blessing right?
Yes
>What happens during your everyday life though?
Sea adventures or sea comfy depending on your tastes
>Does your skin still get pruny?
No
>Do you walk like a free diver or do you swim everywhere?
Don't know

[Anonymous No.]

>ywn get collared by a hellhound.
>ywn try and play it off as some hardcore accessory for your hardcore life style.
>when you light up a cigarette she suddenly show up and puts it out and scolds you for smoking in front of all your friends.

[Anonymous No.]

>>17701942
>scowling at her only makes her rub herself all over you and tell your friends how much you like to snuggle.

[Anonymous No.]

>>17701944
>Complaining only gets her nibbling on your neck to punish you

[Anonymous No.]

>>17701906
Rare to see her knees like that. It's nice to see her getting good art, though

[Anonymous No.]

>>17701949
>Denying it makes her hint at how much you enjoy the leash.

[Anonymous No.]

>>17701942
I'd light up my cig on her firelashes.

[Anonymous No.]

>>17701957
You'll be punished hard for that. With a twelve hour orgasm marathon. It won't stop no matter how much you beg and plead, no matter how tired or sore you get.

[Anonymous No.]

>>17701852

[Anonymous No.]

>>17701959
>begging for her to stop
At most I'll ask her if that's all she has. That's where the fun starts and how you enjoy a hellhound to her fullest.

[Anonymous No.]

>>17701964
Dumb Dargon.

[Anonymous No.]

Remember, the difference between a mere female lizard and a dragon is their cup size. D for Dragon.

[Anonymous No.]

>>17701957
Same but that will just rile her up even more. You want to be careful. What would your friends think if they sww you get carried home to pound town by your waifu when it was lads night out?

[Anonymous No.]

I want to grow illegal drugs with Trailer Park Wurm-chan!

[Anonymous No.]

>>17701967
You are a wise and foolish man anon.

[Anonymous No.]

>>17701974
I'd say that she's my servant and with just a command she'll take me anywhere. I'm making her go nuts and nothing will stop me.

>>17701987
I'll take that as a compliment.

[Anonymous No.]

>>17701906
>Imagine trying to take a Wererabbit from behind
>Only for her to hear you coming with her big ears
>Now you're clinging to her breasts with your legs braced against the ground as she administers a skillful thighjob
>Fluff tickles your rod as pleasure encirles your tip
>You cum in seconds, staining her fluff with your seed
>She just giggles before starting to move again
>She slides your member out from between her thighs, and moves it instead between her cheeks
>Again, you are no match for her fluff, being brought to your limit in moments by her buttjob
>Another giggle, and she slides your manhood back between her thighs
>Now she lets fall her fluff just a tad, slipping you right between the flesh underneath
>Sandwiched between her thighs, with fluff below, she resumes her assault
>Another release
>Another giggle
>
>She's made you cum countless times now
>You begin to lose consciousness
>
>You don't even know how or when you ended up on the floor
>The fluffy bunny is still here, bouncing up and down your shaft like mad as she forces you in and out of her rabbit hole

[Anonymous No.]

>>17701984
Mrs. Lahey's dumb as fuck, Julia, Bubs, and I aren't going back to jail, and we can grow all the dope we want. It's survival of the fitness, gonna have a good fuckin time girls

[Anonymous No.]

>>17701906
I wish to have a respectable and interesting conversation with a March Hare.

[Anonymous No.]

> Succurivus that monitors your preferred 2d girl type both physically and emotionally by examining your post history and picture collection as well as what images you look at and for how long
> Implants a VN into your system, algorithmically places it somewhere you'll find it by monitoring where you look when you start up the PC through your webcam
> She's the best girl by far in the game, after you 100% the game she says that she can't live without you
> leaves the game
> computer girlfriend
> Orders USB-input Automaton pussy so you can give her the D:/

[Anonymous No.]

>>17701992
She probably enjoys such a mischievous husband deep down, it means she doesn't feel guilty when she doesn't hold back.

[Anonymous No.]

>>17702004
>When one begins having a conversation with them, at first it's confusing and impossible to understand. But while having verbal and physical exchanges, and being exposed to their demonic energy and madness, one gradually becomes able to understand their peculiar thoughts and distortions of topics.
In other words, you're the one with a dirty mind, thinking she only talks about sex. Right up until you finally start to understand.

>>17701997
Muh

[Anonymous No.]

>>17701232
Aliens aren't really monster girls, though.

[Anonymous No.]

>>17702020
I thought she takes everything men say as some kind of come on?

[Anonymous No.]

>>17701888
I want one that's haughty and royal in the extreme. Filled to the brim with smugness and the power to back it up.
>>17701896
I think of my baphomet as a heretic that deals with eldritch dieties in dark woods to gain her power and magic. Forbidde n dieties. Dieties that teach the art of paizuri.

[Anonymous No.]

>>17702020
Different anon.

How would a hare respond to someone who can give her a run for her money in the lewd discussion field?

[Anonymous No.]

>tfw no Raiju waifu who is into 80 aerobics videos.
>ywn wake up to a sweaty Raiju dresses in a workout leotard with knee high socks on and sweatbands.

[Anonymous No.]

>>17702033
YOU GOT THE TOUCH!

[Anonymous No.]

Anyone here like Etrian Odyssey? Next commission upcoming!

[Anonymous No.]

>>17702028
Initially, and whenever you speak before understanding how to talk with her.

She, or course, knows how to speak freely. You're just such a pervert you can't help but misunderstand her as well.

[Anonymous No.]

>>17701964
A match made in heaven.

[Anonymous No.]

>>17702035
SHE'S GOT THE LOOK!

[Anonymous No.]

>>17702043
Guess we're made for each other.

[Anonymous No.]

>>17702033
She's a maniac MANIAC!
Oh noooo~
And she's dancin' likr she's never danced before!

[Anonymous No.]

>>17702042
F.O.E
Flabby Onee-san Encounter

[Anonymous No.]

>>17702004
She wouldn't be much of a playmate if she wasn't accompanied by thought-provoking discussions, now would she?

Rest in peace, Hugh

[Anonymous No.]

I need the biggest Titania you got.

[Anonymous No.]

>>17702065
Enjoy your gargantuan Titania with nipples the size of your entire body

[Anonymous No.]

>>17702071
No that's too big.

[Anonymous No.]

>>17702042
Knocking me out, with those big wock thighs.

[Anonymous No.]

>>17702031
>heretic bapho paizuri
All of my want

[Anonymous No.]

Dom the loli Hellhounds
Like this >>17700113

[Anonymous No.]

>>17701803
Shog's disguised as a briefcase!

[Anonymous No.]

QUICK

Pharaoh or Anubis paizuri

[Anonymous No.]

>>17701964
God damn it.

[Anonymous No.]

>>17702093
Pharaoh. Divine command not to peak, so you lay there for hours while she makes you submit ba and ka to her.

[Anonymous No.]

>>17702093
Pharaoh.

[Anonymous No.]

>>17702033
PAPA DON'T PREACH! IM TROUBLE DEEP!
PAPA DONT PREACH! IVE BEEN LOSING SLEEP!

[Anonymous No.]

>>17702093
why not both?

[Anonymous No.]

>>17702075
But you said "the biggest Titania you got."

[Anonymous No.]

>>17702115
because that costs way more

[Anonymous No.]

>>17702093
Anubits are overrated, Pharaoh please.

[Anonymous No.]

>>17702093
Pharaoh-chan won! See you guys with the results in.. Several weeks!

[Anonymous No.]

>>17702093
Pharaoh. Anubi are adept at something else.

[Anonymous No.]

>>17702093
What if I go across the street to the Hathorite temple?
>>17702140
Oh shit.

[Anonymous No.]

>>17702117
Fine, the motherliest.

[Anonymous No.]

https://youtu.be/R7-glnSlIjM
This but with monstergirls.

[Anonymous No.]

>>17702153
https://youtu.be/ApeydDsTplU

[Anonymous No.]

>>17702060
That's uncalled for. There's absolutely nothing flabby about oneesan wocks.

[Anonymous No.]

How can I score a date with a lilim?

[Anonymous No.]

>>17702166
You attend her mother's public birthing ceremony and marry her out of the womb.

[Anonymous No.]

>>17702166
You get strong enough to get her attention, then when she shows up you instantly asked her to go on a date.

[Anonymous No.]

>>17702160
Ok how about this?
https://youtu.be/7ou6MoKmxFQ

[Anonymous No.]

I want a Dragonewt bodyguard!

[Anonymous No.]

>>17702186
That guy was a faggot for not taking her.

[Anonymous No.]

What was this called again? I need my fill of yan-bear.

[Anonymous No.]

Pay the toll of the bridge to the mighty Goblin Warrior?

>Y
>N

[Anonymous No.]

>>17702224
Screw your toll, troll!

[Anonymous No.]

>>17702224
If the toll is lifelong commitment and eternal devotion, sure, why not?

[Anonymous No.]

>>17702224
>N
I have already paid the Troll toll in her Troll hole, I see no reason to be taxed twice.

[Anonymous No.]

>>17702224
I'll push her over and laugh in her face!

[Anonymous No.]

>>17702200
Japs have bad taste.

[Anonymous No.]

>>17702215
I see a nipple in the background

[Anonymous No.]

>>17702242
Why do you think I deleted it. Noticed it too.

[Anonymous No.]

I would need a weresheep or Meaty Dormouse to help me get more relaxed sleeps.

The softer the better.

[Anonymous No.]

>>17702200
She literally has facial hair.

[Anonymous No.]

>>17702228
>>17702233
The toll is now doubled.

Pay the toll?

>Y
>N

[Anonymous No.]

>>17702262
No way! Some tiny troll won't be getting anything out of me!

[Anonymous No.]

>>17702254
Those are scales anon.

[Anonymous No.]

>>17702250
Why not both?

[Anonymous No.]

>>17702275
Is it possible to be too comfy?
A busty, chubby weresheep and at fat bottomed, tubby dormouse would be quite close to it.

[Anonymous No.]

>>17702272
Scales growing out of each other, not uniform in size at all and sticking straight out?

[Anonymous No.]

>>17702262
I've already given her >>17702229, what more can I give?

[Anonymous No.]

>>17702282
There are many types of scales anon. They could simply be layered and grow in and fall out like a shark's teeth, seeing as how such a creature couldn't exactly shed their skin like an actual reptile could. It only gives the appearance of them growing out of each other because of that layering and the art style that it's in.

[Anonymous No.]

Consider the following:
Woodpecker Harpy

[Anonymous No.]

>>17702264
You are no longer welcome to go across the bridge.

You are instead thrown over the side into the river below and captured by the dreaded flatfish.

>YOU CAME https://www.youtube.com/watch?v=CpaT28qMfis

[Anonymous No.]

>>17702309
I got some wood i can peck er with. Namsayin?

[Anonymous No.]

>>17702303
The scales on her arms don't have that problem. Just accept her mutton chops, anon.

[Anonymous No.]

Do plant MGs interpret someone calling themselves a vegetarian to mean that they're into them?

[Anonymous No.]

>>17702323
I literally can't see those as anything but scales anon.

[Anonymous No.]

>>17702230
Here's you toll, Troll.

https://www.youtube.com/watch?v=aDhAEmODyzw

[Anonymous No.]

>>17702337
Okay friend.

[Anonymous No.]

>>17702313
Flatfish don't get enough love.

[Anonymous No.]

>>17702309
Just imagine a blowjob by her at 20 cycles per second.

[Anonymous No.]

>>17702313
But flatfish are cute, why would anyone be scared of them?

[Anonymous No.]

>>17702355
I want to bash some rat girls with my stick.

[Anonymous No.]

The hellhound from across the street keeps picking on me. Teach me how to fight back anons!

[Anonymous No.]

>>17702386
Step 1: Get
Step 2: Good

[Anonymous No.]

>>17702386
Wear a collar around your neck and give her the leash, that'll show her who's in charge.

[Anonymous No.]

>>17702386

[Anonymous No.]

>>17702386
Just compliment her bullying skills. Say it turns you on. Enjoy the new waifu.

[Anonymous No.]

>>17702415
> Your new Hellhound waifu has a diploma on the wall
> it's from the Cornwall University of Bullying, where monster girls big and small go to learn how to optimally bully.
> Onis are using physics to mathematically determine the optimum angle for giving noogies
> The Otohimes are smugly studying the effect of being underwater on toilets so that they can give swirlies
> The Anatomy Of The Ear, a two semester lecture course about giving wet willies
> and most fearsome, the infamous Indian Burn course lead by a near-feral Amazon paid in shiny beads
> thousands of girls in nice uniforms
> there's also that one Elf girl who says that bullying doesn't matter and that they should all just drop out and be loving housewives, but everybody's scared of her so they leave her alone. she can usually be found eating celery behind the gym with her lackies

[Anonymous No.]

>>17702435
I want to volunteer for the Charlie Horse course please! Maybe even the practical pranks 101 class.

[Anonymous No.]

>>17702435
>they should all just drop out and be loving housewives, but everybody's scared of her so they leave her alone. she can usually be found eating celery behind the gym with her lackies
I bet she's a hippie too! A cute hippie!

[Anonymous No.]

>>17702435
I want to be taken to the class where girls learn to use their size and/or weight to their advantage in bullying.

Nothing like being Kabedon'd by a big, buff Minotaur.

[Anonymous No.]

>>17702456
> "Alright girls, we've rounded up a few cute boys from town for the practical exam. You'll be graded on the punchiness, the timeliness, and the laughability of your prank. Not pranky enough, you fail. Too pranky, you've overdone it. You fail. "
> " Remember: Kicking is not a prank. I don't want any more endangerment suits on my desk, BERTHA. "
> " First up, Tabitha with the classic Persian Pursecutor. This is third grade stuff, so don't screw it up. Mr. More, please step forward."
> " Mr. Anonymous, after this is done you'll be partnered with Elizabeth. She'll be performing a hand-designed prank, the Kabe-dunk. Please approach the pool. "

[Anonymous No.]

>>17702469
How does one attempt a Kabe-Dunk?

[Anonymous No.]

>>17702435
Alls fun and games till some anon suicide bombs/shoots up the campus.

[Anonymous No.]

>>17702475
It's sort of like being pushed into a pool but it turns into a kabedon afterward.

[Anonymous No.]

>>17702313
I should cheap out on tolls more often.

[Anonymous No.]

>>17702224
No. I'll create my own bridge.

[Anonymous No.]

>>17702386
Throw her a bone and scratch her ears while she's distacted. Make sure to stream it and end it before she rapes you.

[Anonymous No.]

>>17702477
What the fuck?

[Anonymous No.]

Don't forget to keep Anubi warm in the cold weather, they have trouble warming their ears

[Anonymous No.]

>>17702534
>university dedicated to bullying
>is surprised when someone has enough of that shit and does something like this

[Anonymous No.]

If Odin was a cute loli I'd hug her.

[Anonymous No.]

>>17702552
>literally being so weak that you cant handle voluntary bullying and you go postal.
Anon you have to willingly volunteer for these roles.

[Anonymous No.]

>>17702560
>voluntary bullying
>voluntary
>bullying
Anon are you a wurm?
Also the whole point of the school is to teach them to go out and bully anons in the world, seriously are you a wurm how do you not get this?

[Anonymous No.]

>>17702559
If Odin was a cute loli I'd fug her.

[Anonymous No.]

>>17702386
Just fuck the bully and smug out of her!! That will show her.

[Anonymous No.]

>>17702563
Well its a good thing we got monmanabanana then and they can tell which anons would like to be bullied by cute girls and which anons wouldnt like to be bullied. Anon if we were ever in the situation where a monstergirl was blocking our path and one of us was going to be bullied, id take one for the team so you can be spared her "wrath".

[Anonymous No.]

[Anonymous No.]

>>17702588
No no, anon your too pure and innocent, I'll take one for the team. Keep your virginity in tact and that hand ring less.

[Anonymous No.]

>>17702596
>"Excuse me, waiter? There's a succubus in my tea. I ordered an iced coffee with a bunny girl in it."

[Anonymous No.]

>>17702606
>Bunny girl
Fluffy
Thighs

You're doing this on purpose, aren't you?

[Anonymous No.]

>>17700497
i want to sniff those socked fox feet

[Anonymous No.]

>>17699706
if it helps my dislikes include intact pelvises

[Anonymous No.]

>>17702619
I have the need for a 10ft brown skinned rabbit girl with an athletic frame, large breasts and thighs from which no man can escape all of the sudden

[Anonymous No.]

How do you heal up when your waifu crushes your pelvis?

[Anonymous No.]

>>17702643
MammyBammy.

[Anonymous No.]

>>17702598
You flatter me anon but I insist, plus we don't need you taking anything she does personally.

[Anonymous No.]

>>17702643
she knows restoration/healing magic of course

[Anonymous No.]

>>17702643
My pelvis doesn't break though. Had to grind it before meeting with waifu.

[Anonymous No.]

>>17702643
Holstaur Milk™

[Anonymous No.]

>>17699287
Iron-Beast
Britbong writefag that is known for peppermint tea.

[Anonymous No.]

>>17702652
Na I'll be fine I am a vigilant man, will take a lot more then bullying to take this one down. I definitely can't handle a thigh attack though. Please anything but that.

[Anonymous No.]

Girls from other media you would like to become monster girls

Ivy Valentine - Dhampir

[Anonymous No.]

Good night anons, take care and don't burn down the thread.

Instead, watch out for the windweasel kids down the street.

One never knows whey they may try to 'practice' an ambush on you, even if they are too small to actually follow through with their attacks.

[Anonymous No.]

>>17702674
Well maybe there is two of them. One with nice pillowy thighs and the other a tall muscle girl.

[Anonymous No.]

>>17702733
Alright which one you going to take on, pillow legs or hot dog bod?

[Anonymous No.]

>>17702738
Ill take the stronk one

[Anonymous No.]

>>17702730
I'll team up with a sylphy to fight back. My winds are going to be so strong they'll be thrown away!

[Anonymous No.]

Is there anything better than monster girls in wedding dresses?

[Anonymous No.]

>>17702859
Got any more of them uh



jpg artifacts?

[Anonymous No.]

>>17702859
monster girls in uniforms

[Anonymous No.]

I'm getting tired of one meal a day. When will the portals open so I can get out of this shithole.

[Anonymous No.]

>>17702923
>eating every day
>bitching about it
wew, what a greedy asshole

[Anonymous No.]

>>17702914
>You will never get drug off at night into no man's land and become a husband of war

[Anonymous No.]

>>17702944
I'll never yield to a wolfu soldier! No matter how much they try to smother me with their fluffy tails!

[Anonymous No.]

>>17702859
Can't beat 'em

[Anonymous No.]

>>17702914
Uniforms are nice

[Anonymous No.]

>>17702954
Just give in anon I did a few days ago and I haven't been treated this well since I was at home.

[Anonymous No.]

>>17702859

Nope.

[Anonymous No.]

It's started getting colder where I live. I wish I had some Kitsune Mofu to keep me warm.

[Anonymous No.]

>>17702481
>Water-based monster pushes a guy into a pool
>He starts to hit the water back-first
>The water softens and turns buoyant, cushioning his fall and leaving him floating
>Monster falls on top of the guy chest first, stopping herself from crushing him by catching herself on the water with one arm
>Water splashes just enough to soak her shirt
>Guy is now kabedoned in a pool, starting up at a monster with visible tits

[Anonymous No.]

>>17703028
Mmmm. Warm MG on a cold night. I'd love to get cozy with a warm hellhound.

[Anonymous No.]

What MG would fit best with the type of 80s aesthetic with fast cars, neon lights, and lots of chrome? Think the beginning of Kung Fury or of Tron. Personally, my vote's for a Gremlin.

[Anonymous No.]

>>17703145
Cupid.
Alongside her partner, Eros Pal- er, Cop. Eros Cop.

[Anonymous No.]

>>17703001
>Monstergirl soldiers bring back a bunch of screaming struggling POWs convinced they're going to be tortured and killed by an invading race that doesn't adhere to the Geneva Convention.
>Anon had heard horror stories from some of his senior officers. That these beasts from beyond the portals dragged could snap rifles in half like they were toothpicks and dragged screaming men off the field to be devoured.
>When his turn to be pushed into a tent came, he was practically vibrating with fear.
>The waiting became agonizing, especially after he heard the telltale sound of his comrades being marched away.
>When he felt a hand against his chin, he thought it was the end.
>He expected razor sharp fangs to dig into his neck when his head raised. Instead he was met with a sultry looking girl with fox ears and the biggest pair of tits he'd ever seen in his life.
>That is to say, the only pair of tits he'd ever seen is his life.
>Before he could even process what he'd seen he was mounted and raped for hours.
>By the time anon came to news was coming in to the monster camp about the end of the war and a peace treaty being signed.
>Anon would only learn about it a week later due to the Kitsune General he was given to pinning him to the bedroll and riding him until she got pregnant, which took a while.

[Anonymous No.]

>>17703145
Goblins seem better matched to the 60s Rat Fink style Hot Rods than 80s style chrome.

[Anonymous No.]

>Anon lives in Lescartie.
>He ends up the last remaining pure human due to Earth being an un-magical ball of rock.
>He carries on with his life with somewhat normalcy.
>However this one man would not slip notice.
>He winds up bumping into Druella by accident on the street one day while Anon was running off to work.
>Druella notices first thing off the bat is that Anon has not incubized not one bit.
>And that he's rather a bit of a workaholic when he should be the ecstasies of a monster's embrace.
>She starts digging around and finds out Anon is the last man who hasn't gotten hitched by now.
>Druella kind of sees Anon has a spot on her record and she was damned if anyone was going to ruin her reputation.
>Druella does kind of find it attractive that Anon doesn't turn into a sex starved ape just by being near her.
>Anon just wants to be left alone.

[Anonymous No.]

I think Gremlins need more love

[Anonymous No.]

>>17703206
Your wish is my command.

[Anonymous No.]

>>17703208
>Your wish is my command.
I wish for all our waifus to be real and for each anon's waifu to be next to him.

[Anonymous No.]

>>17703229
I wish I could grant that.

[Anonymous No.]

>>17703206
Such big ears!

[Anonymous No.]

Would you visit the Lescatie guest house?
And yes the kikis are single.

[Anonymous No.]

>>17703282
Well then, I'll help myself to their hospitality.

[Anonymous No.]

>>17703282
I hear they have complimentary room service.

[Anonymous No.]

>>17703282
I would only visit for the matron kiki

[Anonymous No.]

>>17703379
best kiki

[Anonymous No.]

Vampire nibbles

[Anonymous No.]

>>17703169
>Due to a clerical error a Titania gets assigned to be a torturer
>Her vicious tortures include tickles, baking Anon delicious cookies but with no milk to drink them, hugs with no kisses, forcing Anon to watch a scary movie, and sending Anon to bed early with no bedtime story

[Anonymous No.]

ded

[Anonymous No.]

>>17703532
Ms. Wight really need to stop bullying Lich. That just makes her more anti-social.

[Anonymous No.]

Boys who don't like DFC need to be kidnapped, drugged and repeatedly raped until they correct their taste.

[Anonymous No.]

>>17703570
I got converted to the Sabbath yesterday thanks to a certain doujin, sign me up for a cute Baphomet.

[Anonymous No.]

>>17703575
may i ask what doujin would that be?

[Anonymous No.]

>>17703588
https://exhentai.org/g/1121896/64a4ebc191/

Her face and thighs were too much, I think if there was ever a Baphomet like that I'd do everything in my power to make her happy.

[Anonymous No.]

>>17703594
Oh my. Thank you very much sir.
May you find said bapho on the day rifts open in our reality.
I know I will be trying to find a bapho as well

[Anonymous No.]

>>17703570
A club that consists of shotacon CC monster girls exists somewhere.

[Anonymous No.]

>>17703570
What the hell is DFC?

[Anonymous No.]

>>17703645
You think if I dress up in shorts and a propeller hat with a slingshot would I be able to sneak in?

[Anonymous No.]

>>17703655
Abbreviation for Delicious Flat Chest. Are you new around here?

[Anonymous No.]

>>17703612
No problems, glad to help another degenerate.
That doujin got me thinking, soapland play isn't done often enough with monster girls.

[Anonymous No.]

>>17703655
It's nothing. An absence of thing. This thread has a lot of people who hate boobs. They may or may not like dick

[Anonymous No.]

>>17703655
Disgusting Flat Chest

[Anonymous No.]

>>17703645
Liking tentacles makes you gayer than alps.

[Anonymous No.]

>>17703688
>you will never visit a sahuagin soapland

[Anonymous No.]

>>17703206
Only the shortstack and bottom heavy ones.

[Anonymous No.]

I want to teach at an MG high school.

[Anonymous No.]

>>17703801
>Getting advances from the CC headmistress
>The Pharaoh using her god voice to command you to always give her good grades
>Apophis rival to said Pharaoh tries to bite you
>Delinquent class filled with Hellhound, Cheshire cats and Manticores

Definitely one of the toughest jobs in MGE

[Anonymous No.]

>>17703812

at least he's not working retail

[Anonymous No.]

Name one thing better than a shy older man being pursued by an assertive younger monster girl.

[Anonymous No.]

>>17703838
I doubt that anything we suggest will seem more shining or great than what you yourself must be wishing for.

[Anonymous No.]

New version out bitches.

[Anonymous No.]

>>17703867
Oh shit, time to get raped and rape cute girls.

[Anonymous No.]

>>17703867
What's this?

[Anonymous No.]

>>17703838
A shy old man being pursued by an assertive older monstergirl.

[Anonymous No.]

>>17703867
What did they add in?

[Anonymous No.]

>>17703771
>you will never visit a high class soap land with loli versions of wights, pharaohs demons and dragons

[Anonymous No.]

this thread really lacks something what I don't see very often even on muscluar/warrior type mgs.
battle scars

[Anonymous No.]

How would a monstergirl react to an anon saying:

>"Man, I have not had a home cooked meal in a long time. I sure miss those."

[Anonymous No.]

>>17703966
Frantic reading of cookery books and plans to invite anon over with the excuse they made too much.

[Anonymous No.]

>>17703882
What monster will make me never forget ttimes wen I feeled happy?

[Anonymous No.]

>>17703919
Can't I just have a regular sized pharaoh?

[Anonymous No.]

>>17703983
Those are fine too.

[Anonymous No.]

>>17699992
>Detectives Genkiki and Sillyshog work their hardest to impress Police-Chief Anon and try to ease his paper work and press conferences

[Anonymous No.]

>>17703882
Is Juri a good character for beginners?

[Anonymous No.]

>>17704010
But they still can't catch the mysterious Phantom Thief couple.

[Anonymous No.]

>>17703983
You'd probably find only graped Pharaohs there. Not that it makes a difference.

[Anonymous No.]

>>17704019
Wrong thread?

Anyways, would salamanders enjoy playing fightan games?

[Anonymous No.]

>>17704027
I swear on my life I will rescue that Pharaoh.

[Anonymous No.]

>>17704034
For sure. Fighting and sports games always get the sallies going, hard games work nicely too by keeping their fire at maximum.

[Anonymous No.]

Any good content lately?

[Anonymous No.]

>>17704027
I want to grape a Pharaoh and then bully her by only ever fucking her ass and not her pussy while my Apophis wife is on her third kid.

[Anonymous No.]

>>17704027
>graped pharaoh doing soapland play
If I didn't want this before I sure as hell do now, the thought of a once proud brown queen reducing herself to something so slutty is hot as hell.

[Anonymous No.]

>>17704027
As long as they can still do the kinky dom things I want them to do to me.

[Anonymous No.]

>>17704054
A grapesnake waifu and graped pharoah would be a fantastic pair.

[Anonymous No.]

>>17703966
>>17703974
Alright, in that case, let me be within earshot among my colleagues in the cafeteria. Let me just get my friend who is already married to the hellhound guard, and:

>"Man, I have not had a home cooked meal in a long time. I sure miss those."

[Anonymous No.]

>>17704037
I claimed her first! Gonna rescue her with my kindness alone! Then I'll get a just reward!

[Anonymous No.]

>>17703531
Devious! She'd break anyone in one sitting!

[Anonymous No.]

>>17704204
It's just as hard on her as it is on you Anon.

[Anonymous No.]

>>17704227
This makes the pain twice as strong.

[Anonymous No.]

>>17703919
Cutelewd high class lolis > slutty high class lolis

[Anonymous No.]

>>17704236
I dunno.
High class lolis that are personal sluts are fantastic.

[Anonymous No.]

>>17704236
This guy >>17704243 knows what he's talking about.

[Anonymous No.]

>>17704243
>>17704269
Isn't that just business as usual, if she's addicted to husbando having his way with her it can't be helped.

[Anonymous No.]

>>17704318
Nah, they're personal sluts in the way that she'll wear fine clothes but will tease anon by mentioning how she's got nothing on beneath that skirt and how he should just flip it up and go to town on her in public or close to public.

[Anonymous No.]

>>17703570
Over my dead body.

[Anonymous No.]

>>17703570
Not even mamono mana will remove my love for normal tits.

[Anonymous No.]

>>17703570
Ew, what a shitty taste.

[Anonymous No.]

>>17704361
That sounds like an invite to be an undead incubus slave to a lich.

[Anonymous No.]

[Anonymous No.]

>>17704233
> Titania torturer is barely holding her composure.
> " You're going to tell me when your supply train comes in or else I'll..I'll tell you how disappointed in you I am! "
> She barely makes it through the sentence, breaks down into tears.
> " I don't want to be meeeeeaaaannn! "
> She's bawling. A tough looking German Shepherd Kobold nervously edges into the torture tent and hands her a tissue while patting her on the back.
> " Shh, shh. You're doing a great job. Just look at him, he's shivering with fear. "
> The Kobold meets your eyes and silently snarls at you, sending her message clearly.
> Begin quivering in your boots for dear life.
> Titania looks up, red-eyed and sniffling.
> Seeing your apparent terror, she immediately rushes to you and begins stroking your hair and cooing to you.
> " Nooo, sweetie, don't be scared, don't be scared. "
> The Kobold steps in.
> " No, you WANT him to be scared. That's the point. Look, do you want to take a break? There's tea in the Scout tent that I'm sure they'd happily share with you. "
> " Yeah, that's a great idea. Keep watch on him while I'm gone, please. "
> Teary eyed, the Titania walks off.
> The Kobold closes in on you and begins whispering harshly.
> " Look, if you had anyone else I'd start by cutting off your fingers and work my way down from there. However, so as not to hurt her feelings, I'm not going to hurt you one bit. Cooperate, and I'll ensure that you don't get rotated to anyone with a harder heart then her, which is basically everyone in this camp. Do you understand me? "

[Anonymous No.]

>>17704451
Shapely monstergirls in modest formal/casual dress are far lewder that monstergirls in lewd clothing.

[Anonymous No.]

>>17704464
Can I request her as my torturer?

[Anonymous No.]

>>17703570
>mg kidnap men to groom them with zero thought to their fetish
>proud /fit/ amazons turn into strongfats
>sabbath members start turning into christmas cakes
>manticore/dark elves start having wet dreams about being a sub
>goblins getting flatter

[Anonymous No.]

>>17704479
I don't think you understand how being a POW works.
You've been assigned Sherry the Mantis and her cotorturer Aisha the Houri, who manages the speaking part of torturing.
If you're lucky she'll stop when you tell her what she wants to hear.

[Anonymous No.]

>>17704338
>mgc public transport
>a man pulls the loli pharaoh sitting next to him to straddle him in his lap, she lets out a surprised yelp before they start passionately making out with the man copping a feel and neither caring about her skirt hiking up and other passangers seeing him grope her bare ass
>the monsters are amused and the humans being offended makes them even more amused

[Anonymous No.]

I want to get cursed by Eros and then walk around MGC on a Saturday night!
Lonely monster girls will be out on the prowl and they'll try to rape me but my spirit energy will be too unpalatable and they'll leave, blue ovaried and sad!

[Anonymous No.]

>>17704464
>If you had anyone else I'd start by cutting off your fingers and work my way down from there.
Immersion lost

[Anonymous No.]

>>17704495
>Those amazons.
I'm on board.

>>17704501
Exactly.
Lewding those himedere lolis is the greatest.

[Anonymous No.]

>>17704498
So given it's monstergirls, would the torture be the mantis giving anon a Kuu blowjob but never letting him cum while the Houri teases him and pries him for information?

[Anonymous No.]

>>17704495
This is why monster girls need to pay attention to such things.

Those Sabbath members and Amazons would probably be entering a nightmare world.

[Anonymous No.]

>>17704037
How would you react when you "save" her only to learn that she and the Apophis became good friends?
Specifically, how would you react when she tells you this while using her powerful legs to leglock you as the Apophis slithers into the room?

[Anonymous No.]

>>17704495
>proud /fit/ amazons turn into strongfats
>manticore/dark elves start having wet dreams about being a sub
Disgusting

[Anonymous No.]

>>17704607
Well, there's nothing saying that the amazons can't still be doms.

The Dark Elves and Manticores, though, may start having their dom instincts worn away.

[Anonymous No.]

>>17704607
That's what they get for fucking the wrong anon.

[Anonymous No.]

>>17704464

So what happens to you after you cave in after telling them what they want? Will the Titania be glad that they're done torturing you and start to apologize for putting you through it?

[Anonymous No.]

>>17704464
Id cave. She's just so precious.

[Anonymous No.]

>>17704607
I feel sorry for the anon whose amazon does facesitting in revenge to 'keep him in his place'

[Anonymous No.]

>>17704627
After confession comes tea and pastries. She receives biweekly shipments of ginger tea powder and baked goods via the Fairy Line, straight from the ovens of the Fairy Kingdom's palace, as their tribute soldier. She's the only Fairy in the war, as all the others stubbornly refused to go. As you know, you can't force a fairy to do anything they don't want to do. They get twice as stubborn as a Hellhound when you try to make them eat their veggies.
You will be invited to stay in her tent for "monitoring" during the duration of your stay. After all, she doesn't want you having to stay in those nasty, cramped tar-paper shacks they're putting all those poor boys in. Not after all you've been through.
Of course, she's going to make sure that you don't run off or anything. You could get hurt out there, it's a war zone. You'd be better off sticking with her. Since you don't have anything to go back to-not after the Dark Matter bombing of your home town reduced it to ruin- you might even get to go back to the Fairy Kingdom with her, considering that she's in a roundabout way responsible for you. That is, unless you've got other idea.

[Anonymous No.]

>>17704683
I'd succumb at the offer of lap pillows.
I need an Onee-san like her to help me get through recovering from the horrors of war.

[Anonymous No.]

>>17704683
>you might even get to go back to the Fairy Kingdom with her, considering that she's in a roundabout way responsible for you. That is, unless you've got other idea.

Considering my hometown is gone, it's either going with her or just sort of wandering around from there on and probably getting jumped by something else or getting a less than stellar welcome from the people who i was fighting with before. I think I'll take my chances with her

[Anonymous No.]

>>17704769
How would you react if she started sobbing while clutching you because the war's scaring her so much?
All they wanted was love anon. That's the only reason they opened the portals.

[Anonymous No.]

>>17704539
>Lewding those himedere lolis is the greatest.
The best kind of a scenario is the one where they start off being teasing and seductive, but end up being the one who's teased and seduced out of her senses instead.

[Anonymous No.]

>Anon's Journey Ended Here

[Anonymous No.]

>>17704778

I'd give her a hug.

[Anonymous No.]

>>17702923
You're here until death and that's the best case, so buckle up.

[Anonymous No.]

>>17704797
>Young, naive adventurer centaur tries to fight a level 199 Anon.
>Anon doesn't have it in his heart to beat her.
>He just stands there deflecting/blocking all of her attacks while she fights for all that she's worth
>All while she's saying cliche things like "While the fire in my heart still burns, I will never stop fighting!"

[Anonymous No.]

>>17704854
>>17704854
>>Young, naive adventurer centaur tries to fight a level 199 Anon.

[Anonymous No.]

>current year
>not taming memehounds
Explain yourself

[Anonymous No.]

>>17704891
But I'm fine with tamed ones, any sort of hellhound is great in my books.

[Anonymous No.]

>>17704891

i don't like hellhounds much

[Anonymous No.]

>>17704867
>Demon Lord only ascended to power through politics and intellect.
>When it comes time to battle the hero she's woefully underleveled and gets oneshot.
>Hero winds up having to comfort her because everyone was looking at him badly for "bullying" her.

[Anonymous No.]

>>17704769
> Get back to fairy kingdom
> You're basically, compared to the sugar-sweet life of fairies, a PTSD ridden wreck.
> Constantly assaulted with goodies at the market, mandatory snuggles 'to prevent bad thoughts', Onee-san visits you every few hours at a maximum to make sure you're ok, and that' s when she lets you get away from her to work on something.
> Constantly astounding fairies by doing work like picking up a (fairy sized) refrigerator that would take a team of fairies.
> Whenever you're sitting with her she puts her thighs together and moves to the optimal lap-pillowing distance wherever you are.
> If you don't get the hint, she'll futilely pull on you to get you to lay down while trying to coax you.
> Further persistence will be seen as a sign of lasting trauma from the war, and you will be assisted into the position by a team of thirty-forty fairies who will pick you up and place you in the position.

[Anonymous No.]

>>17704891
if you want a tame dog why can't maledom fags stay with kobolds?

[Anonymous No.]

>>17704957
Because they don't put much of a fight.

[Anonymous No.]

>>17704620
People always forget that they can also change your tastes

[Anonymous No.]

>>17702999
>Posts the Lilim who's only recognizable feature is her hat

[Anonymous No.]

>>17704949
This is true, optimal recovery. I don't deserve as much, but I'll try my best for my new fae friends.

[Anonymous No.]

>>17704992
I wonder how those changes actually work.

If a fatfag met a muscle girl who would change first? Does it have anything to do with who has the strongest energy?

[Anonymous No.]

>>17704993
no buli

[Anonymous No.]

>>17705007
Asking for the impossible there, buddy.

[Anonymous No.]

>>17704992
Ok.
But what if one enjoys both?
It's a fusion of the two.


In all honestly, the Monster Girl Sex Ed. Classes really need to cover these things in a "Fetishes, You, and Your Husband" section to prevent this from happening to these poor, under prepared girls.

How do you think soft, cuddly jub jubs feel when they become hulking, muscled raptors with pink feathers?

[Anonymous No.]

>>17704949

>After being there for a few weeks you smile genuinely at one the fairies giving you baked goods
>She and other fairies who witness this are so taken aback by this that after a few moments they cheer and quickly tell everyone about this. One of them even goes to tell the Titania.
>They decide to hold a party later that evening of which you were the center of. All of them so happy that they were able to help you.
>At the party's conclusion you're hugged by nearly every fairy that can find something of you hug, especially by the Titania

[Anonymous No.]

>>17705011
reeee

[Anonymous No.]

To that one Anon:

Fuck you I kind of want to do a Roach prostitute with the same body type as Regura's girl.

[Anonymous No.]

>>17705023
Then do it?

[Anonymous No.]

>>17705031
Roaches are gross, though.

[Anonymous No.]

>>17705023
Do it please, that design is sex.

[Anonymous No.]

>>17705035
Perfect for prostitution.

[Anonymous No.]

>>17705047
>you'll never walk down an alley and get assaulted by an extra aggressive devil bug and her sisters, getting pinning you to the wall.
>You'll never hear the shy ones in the back argue about why the sluttiest one gets to go first
>They'll never argue about how none of them have actually gotten this far before

[Anonymous No.]

>>17705036
>>17705047
Except the best Regura girls are the pure ones!

[Anonymous No.]

>>17705068
Those aren't sluts, they are just normal hirls looking for a husband. Good for taking off the street and raising.

[Anonymous No.]

>>17705014

There is no way I'm not a weeping mess by the end of that.

[Anonymous No.]

>>17705007
>tfw no hat monstrous grill to whisper sweet nothings to you while standing in formation
ITS NOT A HAT ITS A COVER ASSHOLE

[Anonymous No.]

>>17705047
No!

[Anonymous No.]

>>17704891

I don't think that collar is for her... that lingerie is nice though. Really nice.

[Anonymous No.]

>>17705007
What happens if someone else wears the hat?

[Anonymous No.]

>>17705257
time for a duel

[Anonymous No.]

>>17705257
They become the new host.
The hat is Victoria.

[Anonymous No.]

>>17705257
>If I pull that off would you die?
ftfy

[Anonymous No.]

>>17705068
Roaches are meant to be burned.

[Anonymous No.]

>>17705264
no no no no
that shit is why past the expiration date

[Anonymous No.]

>no one remembers CRUSHER, Lani and Kawaiipenis
>the best thread lilims
This thread knows no rhythm, it knows no style.

[Anonymous No.]

>>17705257
>>17705263

[Anonymous No.]

>>17705271
That meme is eternal. Hundreds of people were sacrificed to make it so, and you better fucking honor it.

[Anonymous No.]

>>17705283
Hahahaha.
It's canon now, art made it so.

[Anonymous No.]

>>17705265
Hey man, i hate bugs as much as the next guy, but for some reason i find devilbugs to be extremely appealing. Like, i'd be a bugslut but only for devilbugs.

[Anonymous No.]

what qualifies as a monstergirl?
like where is the cut off point?

[Anonymous No.]

>>17705271
The early iterations of this thread on /a/ were about the time that meme gained prominence, so I think it is fairly appropriate.

[Anonymous No.]

>>17705302
When you reach about 75%.

[Anonymous No.]

>>17705296
They are meant to be atomized.

[Anonymous No.]

>>17705271
You what?
That meme is one of the few that never seems to age or die. It's so powerful people are still doing it over five years after it started. It's like the Old Spice commercial boasts were true but in meme form.

[Anonymous No.]

>>17705280
>Lani
She's not a thread lilim, she's belongs to the no stories and art category.

[Anonymous No.]

>>17705330
So in other words, the same category as the other meme lilims?
The only difference was she used to be pushed a lot more than the other two.

[Anonymous No.]

>>17705134
>While being hugged you start sobbing with little warning.
>The fairies show immediate concern but the Titania reassures them that it's fine.
> She buries your face in her chest, cooing to you that it's OK, to let it all out, etc, then while holding you in a close embrace slowly flies back to her room, the fairies move off of you and decide to leave the two of you be and work on cleaning up.
>When you feel a cover being draped over you suddenly realize where you are. Your mind drifts to the recent events that lead up to this point. You thank her for everything she's done for you and fall asleep from being so mentally exhausted.

[Anonymous No.]

White hawk harpies

[Anonymous No.]

>>17705335
Kawaiipenis and Crusher don't have creators, they were just born from the collective unconscious while lani does.

[Anonymous No.]

>>17705342
That somehow makes her relevant?

[Anonymous No.]

>>17705286
Never forget those that gene their lives during that fateful flight over les baines

[Anonymous No.]

>>17705345
No, of course not. It just makes her different.

Though she is probably one of the worst ones.

[Anonymous No.]

>>17705363
If her creator wasn't a insufferable faggot who insisted on mentioning her all the time she'd be tolerable. He's calmed down now but Still won't shut up about her on the discord and brings her up whenever the relevent ones are mentioned.

[Anonymous No.]

>>17703206
I'm late, but here
https://twitter.com/LucioIsLove/status/913989922515705856

[Anonymous No.]

>>17705384
>Willing to go onto a circlejerk that's basically Mos Eisley with people like Lostpenis getting bullied, the guy pushing Lani, Shoggocks bitching about a fictional writer's block, PsychoFox acting like he invented MGQ and that bloke I met at the pub unironically

[Anonymous No.]

Tell me about the gremlins. Why are their ears like that?

[Anonymous No.]

>>17705402
Other than Psychofox and his delusions of importance and grandeur the circlejerk is alright.

[Anonymous No.]

>>17705384
Funny how pushing her to hell and back got him something though. I still don't know what she is about other than being flat, an attention seeker and candy addicted.

>>17705402
The place is okay most of the time.

[Anonymous No.]

>>17705315
Someone has to love them though, right?

[Anonymous No.]

>>17705263
>>17705283
>Victoria's hat works like SCP-963

I'm okay with this!

[Anonymous No.]

>>17705424
Lani can be pushed as much as he wants, most people aren't going to accept the meme threadcanon lilim anymore than they'll accept Kawaiipenis and CRUSHER.
Steelims were the biggest thread mistake of 2017.

[Anonymous No.]

>>17705428
Yeah a vat of acid loves it when they fall in

[Anonymous No.]

>>17705402
>that recent episode where the circlejerk had a bot kiiled in half an hour of its introduction by pissing off mono with youtube vid spam
>that sanic spam
>that Anthony Birch song
Fuck you that was hilarious.

[Anonymous No.]

>>17705402
Why is that fox looking at computers?

[Anonymous No.]

>>17705424
>>17705412
>Being this delusional

[Anonymous No.]

>>17705449
Because it's 4am and Sub-res has lost control of his life.

[Anonymous No.]

>>17705446
Monorus is still alive?

[Anonymous No.]

>>17705456
If you count being mad at everything that isn't overwatch then I guess so.

[Anonymous No.]

>>17705454
I understand that feeling.

[Anonymous No.]

>>17705467
Does he know that Overwatch is dying?

[Anonymous No.]

>>17705434
Steelims are fine. Selene and Viccy have nice stories.

[Anonymous No.]

>>17705472
Heroes never die.

[Anonymous No.]

>>17705339
I want to pay back this Titania and the fairies. This is healing.

[Anonymous No.]

>>17705488
Bad games do.

[Anonymous No.]

>>17705472
At least the porn is nice
Blizzard fanboys are a dedicated bunch, it'll go on for a long time yet due to them alone.
At least we got some monstergirl art out of it.

[Anonymous No.]

[Anonymous No.]

>>17705528
Kikis look so soft and nice. I just want to hug one when she calls me master.

[Anonymous No.]

>>17705528
>"Oh! What are you doing home so early master?"

[Anonymous No.]

>>17703812
>be a teacher at St. Valkyrie's School for Wayword Girls
>if it wasn't for the amazing pay and benefits you'd never even thought about doing it
>its the first day of the new year And you're busy preparing the classroom
>you then hear a knock on your door and a hellhound police officer opening it asking if you're Mr. Anonson
>you tell her yes you are and she escorts your class in
>you got the typical Hellhounds and Onis who were basically raised in these walls
>then there's the scared and new others consisting of mostly succubi, Minotaurs, and kitsunes who just happened to be in the wrong place at the wrong time
>thank god you didn't have to teach an Ushi-Oni this year
>they're required to have at least three handlers around at all times
>but there's one that caught your attention
>a young, strawberry blonde Elf named Gwen
>you later found out she killed her parents in self defense after looking up her info
>so that's why she's here; reintergration
>she surprisingly became your best student
>you just hope she didn't get too attached to you
>she did
>you then strike a deal with her because you know that you can trust her that you'll marry her after she graduates from St. Val's
>she goes on to graduate and be declared "fit to reenter society"
>oh god that means you have to live up to your end of the bargain
>you know you should've moved to Nebraska when you had the chance
>you're then awoken from your lamentations by Gwen grabbing your hand and leading you to your car
>wait how did she know what car you drive?
>she then stops you at your car and hugs you around your neck thanking you for all of your help
>and to whisper into your ear the fact she's not wearing any panties right now
>sweatingteach.jpeg
>you then take her home to give her her due reward
>when you lock the door to your apartment turn around to see her completely nude with a maddened expression on her face while her pupils are dialated to the point they look like two emerald green hearts staring back at you
>after putting into the perspective that this is the other half of her reintergration
>fully reintegrate her into your mattress that night
>wake up the next morning to her cooking breakfast
>after breakfast and some cuddles you walk down the stairs to the parking garage
>you see your car has cans tied to the bumper with JUST MARRIED written on the back windshield
>you look back up to your balcony to see Gwen in your robe blowing you a kiss
>maybe this isn't too bad

[Anonymous No.]

>>17704464
>their faces when she has a one hundred percent turn rate for her interrogations because no one can deny a crying Titania

[Anonymous No.]

Booty fight!

[Anonymous No.]

>>17705587
I wanna bury my face so deep in a Jiangshi's ass they'd need a rescue team to pull me out

[Anonymous No.]

>>17705587
Can you imagine being sandwiched between the two of them as they ask you to tell them who's is bigger?

[Anonymous No.]

>>17705587
I want to ask for the biggest bootied monster girl the realm to be my wife!

[Anonymous No.]

>>17705587
I'd bury my dick so deep on that dragon's ass people would call it excalibur.

[Anonymous No.]

>>17705587
jiang shi butt best butt

[Anonymous No.]

>>17705601
>Jiangshi wife's face goes aheago and dumbfounded drooling
>She's fully warmed up, but the pleasure alone reverts her to her zombie state
>>17705608
>Dragon wife smugly brags that she owns the legendary sword
>Other dragons are jealous but don't realize she's talking about how deep her husband plows her ass every night

[Anonymous No.]

>>17705587
>anorexic EMG girls

[Anonymous No.]

>>17705614
She would be the best homestay, you'd get to massage her body each morning to help limber her up.

[Anonymous No.]

>>17705618
Shut up Jeanne!
You aren't even the real deal!

[Anonymous No.]

>>17705619
>>17705614
She's perky and spunky too. Would absolutely pick her as my homestay. Probably real fun in bed too.

[Anonymous No.]

>>17705619
>>17705625
thats why jiangshi>vampires

[Anonymous No.]

>>17705617
That dragon is not walking straight for the next days.

[Anonymous No.]

>>17705626
>Bring Jiangshi wife to an undead ball
>You're both peppy sorts, so as a light prank you make sure she spends the whole day before lazy and cool
>Show up to the ball looking dapper and her looking gorgeous, only she's hopping and full zombie mode
>Other high-class guests look on in disdain
>Get to the dance floor and everyone is silently in competition with one another over who can be the most sensual pair of dancers
>start running your hands over your wife as the night goes on
>Her dancing goes from slow and basic to fast and in the groove all the way to her being fully warmed up
>Tangoing with her across the floor in the Dance Macabre, the center of the spotlight as you barely keep up with her lewd gyrations and twists and turns
>almost fucks you right there on the dancefloor
>Rest of the ball is mad jelly as the dance finishes and she struts out with you in tow, her hips swaying and never a more confident step than hers

[Anonymous No.]

>>17705490

>You wake up early morning and you both wake up around the same time. When you tell her good morning she responds in kind with bright cheery smile.
>A little bit later you tell her you want to repay her for your kindness. She's obviously happy by this but tells you she can't think of anything
>Even though she says that she says there is one thing you can do for her personally. When ask what it is she gives you the most heartwarming smile you've seen anyone ever give you
>"Just keep smiling" is all she says.

[Anonymous No.]

>>17705626
I forget. Don’t Jiangshi have some special alt. monsterization ability that has something to do with their nails?

[Anonymous No.]

>>17705684
Their claws cause human women to "die" and become more Jiangshi.

[Anonymous No.]

>>17704854
>Level 199 Anon wastes a ton of time doing nothing
>The dreaded level 200 Elite Automaton Centaur patrols into him by chance
>It swats him 5 times putting him in a low HP state
>Lower level Centaur gets the last hit
>Automaton Centaur continues on her patrol unimpeded
>Level 199 Anon is forcibly married to a level 30 Centaur
>The guild never let's go of this knowledge and uses it every time they can

Mother fucking, FEL REAVER Automatons.

[Anonymous No.]

>>17705694
That's brutal

[Anonymous No.]

>>17705699
>Spoiler
PTSDflashBack.png

[Anonymous No.]

>>17705706
Make sure to tell your Zombie Hopper to clip her nails.

[Anonymous No.]

>>17705699
She's cute.

[Anonymous No.]

>>17705712
So I can put them In a gun and fire them at random women

[Anonymous No.]

>>17705715
Goodness.

[Anonymous No.]

>>17705699
>tfw I would be okay with a lvl 30 centaur
>especially if she was German and wears Drindls constantly

[Anonymous No.]

>>17705699
https://www.youtube.com/watch?v=xnIBFAYtmQ0

[Anonymous No.]

>>17705670
>Meanwhile, back at your home town, your comrades have all fallen to succubi as the air grows thick from all of the DE spread by the dark matters
>Those who had human wives stay together even after their transformation
Love wins after all. I guess?

[Anonymous No.]

I need a group of fellow Anons to help me form a Spirit Squad and take down Monster Girl Wrestlers.

https://www.youtube.com/watch?v=vHeqX0DPh3k

[Anonymous No.]

>>17705699
>Level 199 Anon is forcibly married to a level 30 Centaur

Well she would've gained a significant amount of levels from beating anon alone.

[Anonymous No.]

>>17705718
That's the closest you can get to being a mass murderer In mge land

[Anonymous No.]

>>17705733
Well, whatever gets your rocks rattlin and makes your waifu feel pretty.
>"Oh honey, this manicure feels so nice~"
>GATGATGATGATGATGATGAT

[Anonymous No.]

>>17705706
It's like getting bitten by a Zombie.

[Anonymous No.]

>>17705728
She's probably level 50 now and anon will train her to his level so she doesn't cum on penetration.

[Anonymous No.]

>>17705699
At least it's not the Knights of the Silver Horseshoe.

That would be a difficult fight.

[Anonymous No.]

Ah.

[Anonymous No.]

>>17705727
I'd be up for that, as long as I'm not the dolph ziggler of the group. You know, since he fucked amy schumer.

[Anonymous No.]

>>17705745
she needs a hug

[Anonymous No.]

>>17705748
Man, I know im here to fuck monsters but that's just too much

[Anonymous No.]

>>17705745
I recognize this Fox, I think she works at the Mofu Club!

[Anonymous No.]

>>17705745
Desperation is cute.

[Anonymous No.]

>>17705748
amy schumer as an ugly fat
unfunny Cheshire

[Anonymous No.]

>>17705760
What the fuck is wrong with you.

[Anonymous No.]

>>17705745
What a cutie!

[Anonymous No.]

>>17705757
I want to do lewd things to that old fox!

[Anonymous No.]

>>17705760
Please don't insult fat unfunny cheshires like that.

[Anonymous No.]

>>17705767
>ywn make an old fox feel young again
>ywn then surprise the old fox by going another couple of hours pounding away at her quivering pussy while she starts to protest and beg for a break

[Anonymous No.]

>>17705745
Someone's gonna gait their tail snuggled in a sec.

[Anonymous No.]

>>17705770
you see I only go for women who have their ages measured with four digits.

[Anonymous No.]

>>17705745
Wait a minute, I know that daki.

Latenight confirmed for good taste in anime.

[Anonymous No.]

>>17705608
I want to plow a flat loli dragon's big butt.

[Anonymous No.]

>>17705789
Ah a man of culture I see.

[Anonymous No.]

>>17705745
How big of an ass does that fox have under her mass of mofu?

[Anonymous No.]

>>17705723

>You continue stick around. Helping the little fairies with anything they may need; especially any heavy lifting.
>Eventually you marry the Titania and the fairies hold a huge celebration with monster girls from outside the fairy kingdom

[Anonymous No.]

>>17705816
>marry a Titania
>suddenly become a king
Just went from a ten to an eleven.

[Anonymous No.]

>>17705816

[Anonymous No.]

>>17705803
I want to plow a normal crimson dragon's big butt and calm her raging fire with my lewd cum.

[Anonymous No.]

One of my biggest fears with monster girls is lets say you order a pizza and both of you get a topping on your own half. She will usually end up taking slices off your side but the unusual topping she gets keeps you off her side. What are those toppings? Luckily my waifu is a Wendigo so she probably gets meat lovers.

[Anonymous No.]

>>17705865
>hellhound waifu
Luckily nothing she could get would keep me away from that pizza, I love both meat and spicy food.

[Anonymous No.]

>>17705865
I really want to see how they react to pineapple topping.

[Anonymous No.]

>>17705880
>*confused awawa's*

[Anonymous No.]

It doesn't matter where I go, or in what community I show it. Universally evertime I compare monster girls, Hellhound ends up being the most popular. I simply can't explain it, even in non monster girl groups. All logic tells me monsters like Inari and Holstaurus would be the most popular among most men.

[Anonymous No.]

>commission a monster girl a while back just because "she's a race I like"
>start thinking about her more often
>now thinking about her is the best way to guarantee I can sleep
Is this what I think it is? Did I finally find the one?

[Anonymous No.]

>>17705902

sure sounds like it. who is she, anon?

[Anonymous No.]

>>17705865
I bet she'll get some meat or somethin spicy. I don't like spicy things too much, but at least she only likes pineapples desserts.

[Anonymous No.]

>>17705909
Hellhound?

[Anonymous No.]

>>17705919
A dragon.

[Anonymous No.]

I just found a picture of Laska in kikebook and people are asking who she is. You should be proud bob.

[Anonymous No.]

>>17705919
>hellhound at reasturant
>order something spicy for both of us
>just assumed she liked spicy stuff
>she cant handle spicy food
>too prideful to admit she cant kindle spicy food
>tries to play it cool while sweating like crazy

[Anonymous No.]

Big.
Meaty.
Kakuen

[Anonymous No.]

>>17705906
She's an undead.

[Anonymous No.]

>>17705943

Which undead though?

[Anonymous No.]

>>17705935
Time to play with her tits.

[Anonymous No.]

>>17705935
If I pay her in food will she teach me some martial arts? And I actually mean food not semen.

[Anonymous No.]

>>17705757
I heard that the mofu club is just a front for the mofu mafia! Doesn't anybody ever wonder why they have those big mean manticores and hellhound bouncers?

[Anonymous No.]

>>17705950
I dunno.
Chunky monkey buns sound quite nice to play with.

>>17705960
Maybe.
Depends on how much and how good.

[Anonymous No.]

>>17705963
The mofu mafia isn't real, anon.

[Anonymous No.]

>>17705966
The fat kakuen was expecting me to play with her ass but I'm going to use her tits instead. Poor girl will feel so defeated and horny she might even atempt rape.

[Anonymous No.]

>>17705963
I'd be careful anon bad things happened to the last person to bring this up.

[Anonymous No.]

>>17704891
>No big meaty paws
>No chest fluff
That's a low level Hotdog if I've ever seen one.

[Anonymous No.]

>>17705946
The rich and fancy kind.

[Anonymous No.]

>>17705524
What does a Yeti need a cryo hair dryer for?

[Anonymous No.]

>>17705982

Ah i hear ya. Good taste.

[Anonymous No.]

>>17705976
You sure you don't want to play with it?

It's a large, heart shaped one with some wide, accompanying hips!

[Anonymous No.]

>>17705963
That silly fox isn't a member though, she's blissfully unaware of all the shady dealings that go on.

[Anonymous No.]

>>17705996
I mean, I'd probably end up fucking and cumming in her so hard later that she looked full and there was a cum pudle forming under her, but before that I'd definitely keep teasing her tits over and over.

Bitting her nipple, giving it big squishes and using them for paizuri.

[Anonymous No.]

>>17705963
the mofu club is a fine establisHment where yEtis don't hoLd you against your will with cuddles, Please don't say such rude things

[Anonymous No.]

Hathorite Pharaoh.

[Anonymous No.]

>>17705966
>prepared a meal that lasts a human man for days.
>present it to the kakuen who scarfs it all down in a matter of minutes.
>astonished you ask how she liked it.
>"Eh, could of used some more spice". She lays back and starts to fall asleep.
>defeated you hang you head and start to head home.
>"Hey aren't you going to stick around? After my nap we can start your training?" She says in a yawn.
>you stick around for a bit and fall asleep as well only to wake up as her little spoon.
>quickly move yourself before she wakes up and gets the wrong idea even though she was the one who grabbed you in her sleep.

[Anonymous No.]

>>17706006
But they're the smallest part of her!
Come on!

You may be filling that rear but you gotta slap it! Spank it! Make her squirm and moan!

[Anonymous No.]

>>17706017
I've always envisioned Hathorites having soft, fluffy hair to go along with their thiccness.

[Anonymous No.]

>>17706027
Exactly.
Master (or is it mistress?) Kakuen is a tough act to get going.

But once you do, she'll have you walking out a champion.

[Anonymous No.]

>>17706011

Where are they keeping you anon?

[Anonymous No.]

>>17706029
C'mon anon, of course I'm going to spank it. In my free time I'd worship Ares and arm wrestle wurms just so I could slap that ass so hard she cums with the strength of a thousand ushis everytime.

[Anonymous No.]

>>17706035
>Manticore's fur goes from bristly to soft as she changes thanks to Hathor

[Anonymous No.]

>>17706043
probalby in a basment under threat of cold showers and cuddles if he doesnt comply

[Anonymous No.]

>Be at the vidya store buying stuff for you and your BF
>Have him under contract but he doesn't seem to mind, surprising you with a new console
>Suddenly, during checkout, this girl comes up and hugs him
>WYD?

[Anonymous No.]

>>17706048
Thats good.
And make sure you're slapping it nice and good.

The ample padding means that only the strongest, or most well trained, touch can get her to feel it.

[Anonymous No.]

>>17706055
do i even have to say it

[Anonymous No.]

>>17706035
I feel like most monster girl species are improved by making them Hathorites. Take for example the Hathorite Dark Mage

[Anonymous No.]

>>17706079
I want to help a Hathorite convert women!

[Anonymous No.]

>>17706064
The whole neighbor will know that I'm slapping nice and good with the way she'll be moaning and screaming. If they don't, the way she walks will give it away.

Though people looking and and talking about it might make me want to go at it again.

[Anonymous No.]

>>17706079
The Milk Magician is a force to be reckoned with!

[Anonymous No.]

>>17706079
>Hathorite Dark Mage
>she has over 1000 lactation potion recipes
>and wants to try them all with her favorite assisstant

[Anonymous No.]

>>17706087
Anon please.
Even a bottom as big and soft as hers can only take so much punishment.

She'll be walking on her tip toes because its so sore!

And given the revealing nature of monster girl clothes, there may be a few handprints everyone sees.

[Anonymous No.]

>>17706087
Jane Goodall wouldnt approve of this please respect the primates

[Anonymous No.]

>>17706040
>Finally win your first tournament after getting trained by Master Kakuen.
>Return back to her place after being gone for sometime.
>Bring your trophy and a fredh meal with you.
>She is happy to see you and proud to see you have won a tournament knowing how much martial arts means to you.
>After eating she takes a jab at your cooking.
>"It could still use some more spice" she jokes.
>Spend the rest of the night drinking with your former master before the both of you retire to bed.
>Wake up to find that she made her way to your room and is holding you again.
>This time you make no effort to move, instead you just lay there and enjoy her embrace.

[Anonymous No.]

>>17706079
Most monster girl species are improved by making them pear shaped lolis. The ones that aren't are improved by making them normal shaped lolis

[Anonymous No.]

>>17705745
>>17705750
>>17705783

>>17705811
Answer: Enough

>>17705793
thumbsup

[Anonymous No.]

>>17706105
Good man.
She may not be fighting all that much anymore but she's still strong enough to keep you there if she wants.

>>17706121
Lewd!

[Anonymous No.]

>>17706121
What is enough of an ass?

[Anonymous No.]

>>17706079
I want to be the chosen champion of hathor herself!

[Anonymous No.]

>>17706098
>Punishment
Huh? I'm just doing my best to be a good husband, anon. Punishment would involve me playing with her and she wouldn't be allowed to wear underwear. Not only that but there would also be pleasure runes on her ass along with a nice vibrator that I shoved in there. If I'm feeling bored all I'll make some music with her moans.

>>17706103
Imagining such a nice girl being at my disposal is just too much. It makes me want to fuck her like an animal and do things that would make a succubus blush.

[Anonymous No.]

Another wife commission finished!

[Anonymous No.]

>>17706130
You want to be the husband of a crybaby goddess like her?

[Anonymous No.]

>>17706135
Frickin cute

[Anonymous No.]

>>17705963
You don't wanna know how deep this rabbit hole goes anon! You might end up married to a rabbit girl.

[Anonymous No.]

>>17706133
Anon, making a big, soft kakuren suffer all those sensations is going to reduce her to an ahegoing mess just from slaps and spanking!

[Anonymous No.]

>>17706011
Good luck anon, you have a long night ahead of you.

[Anonymous No.]

>>17706120
How incorrect of you. What does it take, I wonder, to warp a mind in that way?

[Anonymous No.]

>>17706135
Gazers are into facesitting aren't they?

[Anonymous No.]

>>17706147
As soon as she puts her tongue out I'm giving her a big sloppy kiss while still slapping and pounding that ass. Or maybe I could just finger her and with the other hand I'll pinch her nipple.

[Anonymous No.]

>>17706167
he fell for the trap and squished a loli flayer

[Anonymous No.]

>>17706200
fat butt

[Anonymous No.]

>>17705963
I want to marry a Hellhound bouncer.

[Anonymous No.]

>>17706201
I can only imagine that everyone is going to be amazed at such a big girl being manhandled by you.

[Anonymous No.]

>>17706053
>Mafia Yeti keeps a walk-in freezer that locks from the outside to get poor schmucks to talk
They tried to give her the nickname "Ice Queen" once, but that resulted in the town being a freezer until the neighboring Ice Queen made her change

[Anonymous No.]

>>17706200
I'd beg so much it wouldn't matter.

[Anonymous No.]

>>17706200
Nope, but gazerfag is clearly addicted to facesitting. He has good taste on that.

[Anonymous No.]

>>17706218
can a man get any lower then begging a monoeye for facesitting?

[Anonymous No.]

>>17706216
They're only torturing themselves at that point.

[Anonymous No.]

>>17706226

.....I could sign her up for those aforementioned bullying classes and encourage her to tie me up.

[Anonymous No.]

>>17706226
Nothing wrong with that if she's a thick MGE blueberry.

[Anonymous No.]

>>17706207
How big are we even talking? Anyway, with the amounts of sex we would be haivng her body would probably need a break but I'm not so sure about that. It would be hard to resist forcefully eating her out while her ass recovers.

[Anonymous No.]

>>17706243
I imagine she'd be around 7 1/2 feet with a notable amount of muscle and a bit of pudge to go with it.

And forcefully eating her out would be quite the thing to see, although she may not be resisting all that hard.

[Anonymous No.]

>>17706227
It's not the pain of the cold freezer that makes them spill the beans, it's the soft, loving embrace of the Yeti rubbing their back, lulling them to sleep on a warm bed and a heavy fur blanket, promising to keep your secrets safe and keep those awful trembles away

[Anonymous No.]

>>17706247
That's a pretty big monkey, so it means I'd just have to get big as well. Something that makes her stomach bulge with every thrust should be enough.

Also, if she doesn't resist I'll take that as an invitation to go even further. I'd get up and start playing with her nipples with my mouth and hands while my cock slowly touched her labia. If she keeps being so submissive, she might end up in a mating press.

[Anonymous No.]

>>17705757
I want to fuck the smug out of the old fox and her sister.

[Anonymous No.]

>>17706167
There's no mistake. Little girls with big butts are the most desirable.

[Anonymous No.]

>>17706121
UHO! MOFUMOFUMOFU

[Anonymous No.]

>>17706273
rip anon

[Anonymous No.]

>>17706275
Greater love hath no man than this, that a man lay down his face in mofu.

[Anonymous No.]

>>17706280
That looks really comfortable, I'm jealous.

[Anonymous No.]

>>17706005
Genki foxes are truly great.

[Anonymous No.]

>>17706273
Dibs on the box.

[Anonymous No.]

Fear the old fluff.
By the goddesses, fear it.

[Anonymous No.]

>>17706290
Joke's on her, I can see that trap coming a mile away!

[Anonymous No.]

>>17706273
>Open briefcase mofu pops out
>Neighbor opens his briefcase faggot cat pops out
>Other neighbor grabs his baseball gear and a mofu ball pops out

THEY CAN'T KEEP GETTING AWAY WITH THIS

[Anonymous No.]

>>17706267
You're gonna get her heart pupiling in no time.

[Anonymous No.]

>>17706296
It's mamonobama I don't have to explain shit.

[Anonymous No.]

>>17706290
This is how crafty, old Foxes catch young, naive boys.

[Anonymous No.]

>>17706290
>implying Byrgenfluff is so quick to relinquish its secrets

[Anonymous No.]

>>17706302
Good. Chances are that she ends up being pregnant and I'll be a happy father.

[Anonymous No.]

>>17706320
I want to fight the mofu yakuza.

[Anonymous No.]

>>17706333
Can you really stand up to the might of twin mofu? Or is this just your way of becoming the bosses' special boytoy?

[Anonymous No.]

>>17706336
I'll fight with anon he won't stand alone!

[Anonymous No.]

>>17706336
Twin mofu are easy if you abuse heat moves and constantly drink energy drinks.

[Anonymous No.]

>>17706303
MGs are villains!

Villains ruining common business and home items with their wicked perversions!

[Anonymous No.]

>>17706328
But then that big chunky monkey is going be be carrying multiple kids and wanting to hang off of you!

[Anonymous No.]

>>17706206
Are you sure you want that? You know she's gonna be covered in scars because she's had a rough life, right? She's probably not gonna hold back in bed either.

[Anonymous No.]

>>17706340
>>17706342
>>17706343
Lot of shounen heroes here today. Let this anon be an example of what happens to those who challenge the mofu mafia.

[Anonymous No.]

>>17706363
I didn't know Yakuza was a shonen.

[Anonymous No.]

>>17706345
Hey now, I did say I'd be getting good for her and I didn't meant in cock only. I'd carry her in my arms anywhere she wants, and when our kids are born I'd be able to carry the whole family.

[Anonymous No.]

>>17706363

[Anonymous No.]

>>17706336
>Getting made to wear silken pants and a Chippendale's collar with a bow tie in a room with the Twins
>They're both on either side of you, giggling to themselves
"He's so tense, sister dearest! It's almost as if he thinks we're going to hurt him!"
"Oh, but we are going to hurt him, sister! We're going to 'hurt' him all night long!"
>Their tails converge on you while they each open one eye
>...
>When one of the attendants checks on you and the sisters, she's forced to rush away from the room, red faced and scared for her life
>The small lounge heady with the smell of sex as one of the granny foxes straddles you, seated on the couch and the other embraces you from behind
>Your bodies shrouded by the massive sea of golden-grey mofu, both of them 'ufufufufu'ing as they make you into their boytoy

[Anonymous No.]

>>17706397
There are worse ways to live.

[Anonymous No.]

>>17706336
I'd rather date their daughters.

[Anonymous No.]

>>17706397
That sounds very scary.

[Anonymous No.]

How amazing would it be to be captured by a group of devil bugs?

[Anonymous No.]

>even the WAR GOD doesn't want anyone to die

Something's not quite right...

[Anonymous No.]

Is it REAL OLD hours?

[Anonymous No.]

>>17706436
Can't very well carry on a war with everyone dying. Total waste of manpower. Better to keep everyone alive and let them fight it out eternally.

[Anonymous No.]

>>17706439
I wonder, what the fuck is the god of death thinking while all this erogenous abuse of immortality is going about? I mean the grim reaper has to be pissed because no one is dying anymore.

[Anonymous No.]

>>17706426
fox face

[Anonymous No.]

>>17706443
God of death is fine with people being undead. She even protects them from dying.

Also, I'd let Ares watch me and my waifu fuck.

[Anonymous No.]

>>17706443
She's fine.

[Anonymous No.]

>>17706397
I swear, some guys get all the luck.

[Anonymous No.]

>>17706455
Shit art.

[Anonymous No.]

>>17706452
Is there a fundamental force that isn't compromised here? Next you'll tell me gravity is in on it, too.

[Anonymous No.]

>>17706460
The only good art i could find that wasnt deviantart tier.

[Anonymous No.]

>>17706461
I mean, people don't drown when they go underwater, they just go unconscious. If you jumped from a really high place in somewhere like Lescatie you'd probably just float down.

[Anonymous No.]

>>17706467
And we all know suicide doesn't guarantee you'll stay dead.

So what, you'd have to chuck someone into the void of space? Is that the only way for someone to really die anymore?

[Anonymous No.]

Which bug is stinkier?

[Anonymous No.]

>>17706449
Fox Rape.

[Anonymous No.]

>>17706443
She's thinking about the not!deadpool of the setting and how to break his pelvis.

[Anonymous No.]

>>17706471
Depends on how far mamono mana goes. If it reaches space it would probably just have the same effect as drowning until a monster girl comes to rescue you.

[Anonymous No.]

>>17706477
im just saying she looks like the kind of face you see in old anti Japanese world war II propaganda posters

[Anonymous No.]

>>17706484
Yao is cute! CUTE!

[Anonymous No.]

>>17706484
How so?

[Anonymous No.]

>>17706489
dude c'mon

[Anonymous No.]

>>17706489
Add some buck teeth and a rice hat and it would look pretty close to ol Hirohito.

[Anonymous No.]

>>17706480
Does space exist there? Are there aliens? Are the aliens already infected?

[Anonymous No.]

>>17706493
I always wondered how she ate food.

[Anonymous No.]

>>17706493
>>17706495
>Talking shit about Yao

Shameful.

It's like you hate fox MGs or something.

[Anonymous No.]

>>17706505
Mybae he's just not into shark teeth.

[Anonymous No.]

I want to slap Wurm-chan around with a sock full of nickels!

[Anonymous No.]

>>17706505

[Anonymous No.]

>>17706505
I like old foxes

[Anonymous No.]

>>17706511
She wouldn't even notice.

[Anonymous No.]

>>17706500
Eh, there is probably a space but I don't know about ayys. Maybe you just have mgs flying really high up there.

[Anonymous No.]

>>17706505
only goood thing about her is the fact shes a buttslut

[Anonymous No.]

>>17706510
See, now he's hating on Fox MGs and Shark MGs!

Tie that Warlock to a pole and burn him!

[Anonymous No.]

>>17706522
What a waste of spirit energy. How about you set him adrift instead, and let the Mersharks do some persuading?

[Anonymous No.]

You're all talking about the wrong type of foxes.

[Anonymous No.]

>>17706535
Old foxes that you need to fuck the fertility back into > young foxes .

[Anonymous No.]

>>17706546
Not that

[Anonymous No.]

>>17706535
the ones that eat livers?

[Anonymous No.]

>>17706554
with some fava beans and a nice chianti.

[Anonymous No.]

>>17706397
I wonder what they'll do to him when he passes out from exhaustion

[Anonymous No.]

>>17706554
Yes

[Anonymous No.]

>>17706352
All the better. I want to kiss her scars and tell her I think this only makes her look sexier and makes me feel safer when Im with her.

[Anonymous No.]

>>17706535
Is it true that if a kumiho eats your liver, you can feel her soul against your own?

[Anonymous No.]

>>17706474
The left, obviously

The one on the right's stink can be fixed by cleaning your house.

[Anonymous No.]

>>17706586
Only if you two have been together for a while

[Anonymous No.]

>>17704949
>>17705014
>>17705339
>>17705670
>>17705816
>>17705827
And this is why Titanias are top tier MGs.

[Anonymous No.]

>>17706610
Amen.

[Anonymous No.]

I hope officer hotdog places me under arrest!

[Anonymous No.]

I wanna perform cunnilingus on my waifu!

[Anonymous No.]

>>17706668
I want to go down on officer hound!

[Anonymous No.]

>>17706668
I wouldn't mind some police brutality from her

[Anonymous No.]

>>17706528
>out of my league
wwwwwwwwwwwwwwwww

[Anonymous No.]

>>17706671
>going to Wonderland
>ever

F O O L

[Anonymous No.]

>>17706681
Don't be rude, sir. That's my waifu's hometown you're besmirching.

[Anonymous No.]

Good night anons, take care and don't burn down the thread.

Instead, keep an eye out for the stealthiest desert girl.

Girtablilu is going to do all she can to remain relevant!

[Anonymous No.]

If a Hellhound went swimming and got water in her ear, would it come out as steam?

[Anonymous No.]

>>17706696
Not if hellhoundfags have anything to say about it

[Anonymous No.]

>>17706696
So stealthy that nobody remembers her.

[Anonymous No.]

>>17706681
I wanna take my mice family to wonderland and get half of them turned into dormice!

[Anonymous No.]

>>17706684
Then you are already mad!

[Anonymous No.]

>>17706707
We're all mad here! I'm mad, you're mad~

[Anonymous No.]

>>17706696
>Omae wa mou tsukareta
N-Nani?

[Anonymous No.]

October 2017 is starting anons, are you ready for the waifus?

[Anonymous No.]

>>17706730
Isn't the big festival usually on the transition from April to May?

[Anonymous No.]

>>17706730
Frankly, no. I’ve got shit to do. I don’t have time to worry about romance.

[Anonymous No.]

>>17706519
At some point we're going to have to accept it's monster girls all the way down. There'll be higgs boson monster girls soon. If you don't want sex in the MGE universe, you are truly fucked, literally.

[Anonymous No.]

[Anonymous No.]

>>17706697
>"Hey, do you hear a bubbling sound?"

[Anonymous No.]

>>17706746
>You are already fucked!

[Anonymous No.]

[Anonymous No.]

Would you wash a centipede's back?

[Anonymous No.]

>>17706763
>From my point of view, the monsters are fucked!

[Anonymous No.]

>>17706746
These damn non-time-linear monster girls keep stealing my virginity! It keeps happening!

[Anonymous No.]

>>17706780
>tfw you will never play 4D chess with a monster girl

[Anonymous No.]

>>17706703
Translation never.

[Anonymous No.]

>>17706780
I WARNED YOU ABOUT MONSTER GIRLS BRO

I TOLD YOU DOG

Never thought I'd get to use that meme again, I tell you what.

[Anonymous No.]

>>17706802
>I tell you what.
Dammit, Bobby.

[Anonymous No.]

>>17706750
>you will never read lewd fanfiction with a merrow