/ck/ - Food & Cooking

>>15516954
>change crop to have bigger yields
>civilisation collapses

>>15516954
"no"
enjoy your tendentious, shitty thread

>>15516954
this is fact and people scared of GMOs can fuck right off together with antivaxers and other soccer mom conspiracy theorists

>>15516954
the original corn looks pretty cool.
I wonder how many more different varieties of vegetables we could have if we bothered to cultivate the other thousands of wild species.

>>15516954
Selective breeding is not the same thing as splicing salmon DNA into a watermelon, Monsanto shill.

Wow hot take anon! Selective breeding and genetic engineering are obviously completely different you RETARD

>>15517009
The fact Monsanto is trying to monopolize the food supply is the only issue I have with gmo.

>>15517009
>salmon
>edible and delicious

>watermelom
>edible and delicious

whats the problem?

>>15517009
mmm watermelmon

>>15516984
lol stupid comparison anon
Vaccines have proven to be very efficient and clearly saved millions of lives without any of the side effects that antivaxxers claim
on the other hand GMOs can only lead to dangerous monopolies and uncontrolled spread of mutant crops

>>15516991
>the original corn looks pretty cool.
It's interesting to see how plants can change. Like pic related. But I think eating the original corn would be like mostly eating the cob itself.

>>15517009
>tfw no watersalmon

>>15517009
on the one hand splicing and introduction of foreign genetic material happens all the time in nature

on the other hand, what the fuck are you afraid of? a plant suddenly producing a toxin? you just test the hybrid and treat it like any other plant derived from selective breeding

gmo tinfoils are retarded
sure selective breeding is slower because you rely on randomness, but the end result is the same
a new plant you treat as such

>>15516954
Nope. GMO means that recombinant DNA technology was used to selectively splice and edit genes that could never exist in nature.

Ordinary plant breeding isn’t the same thing. Also, Bayer-Monsanto should be avoided as well as any food products which use their products.

>>15517071
You’re being dishonest and nobody wants your GMO cancer causing frankenshit.

>>15517071
>big seed company test GMO strawberry with say, sterility or resilience to some stuff
>tests "leak" and modified DNA strawberry starts to overtake the regular one
>now all the strawberrys are sterile
lol

>>15516991
We tried. Guns germs steel by Jared diamond has a part addressing this. Every cultivatable plant shares a few key features and almost all the wild ones in any area where people live have been domesticated over the last 12000 years. We might be missing some from the jungle or Australia, but other than that we got all the ones that are feasible.

>>15516954
GMO isn't bad because it's modified, GMO is bad because Monstanto patents the process to get the modification and the modification itself, and then sues everyone who so much as gets a single GMO seed blown in from the wind into their crops.
Also they forbid seed collection so you have to buy new seeds from them every single season.

>>15517099
>modified DNA strawberry starts to overtake the regular one
how would that happen if they're sterile?

The healthiest food you can give the body is food that hasn't been altered in any form. Whether it be GMO or hybridization, non-original foods create mucus, which is the source of all ailments and disease.
When you feed on completely unaltered foods, the system detoxes, releasing trapped mucus, and flushing toxins.
This is how Alkaline forming herbs, fruits, and vegetables help people heal from illness and prevent disease.

>>15517072
Ordinary plant breeding is exactly the same thing. Corn that big couldn't exist in nature, it requires more resources than it's worth evolutionary by many times. You're being retarded.
>>15517075
Pussy
>>15517099
Then the farmers just don't plant those strawberry seeds, retard. Do you think that they grow naturally? Christ you're thick.
>>15516964
>I'd enjoy this thread much more if it said "Do Americans really"
>>15517126
Is all the opposition to this shit on this just trolling?

>>15516954
>breeding is the same as genetic engineering
Hello stupid

>>15517135
Broccoli – Being that broccoli is hybrid, unnatural, incomplete molecular structure, it should not be consumed by humans. GMO fruits & vegetables – Genetically Modified foods are never recommended. Dr Sebi: Now for us to eat, you have to have in your big skull the understanding of biochemistry, but when we were here [pointing to word Africa on the white board] we didn’t have to know anything about biochemistry.

>>15517071
>engineer varieties of plants that are intentionally sterile so farmers have to buy your seed year after year instead of saving their own

fuck that, and fuck you rent seeker

>>15516954
This isn't enough of an argent for anti-GMO fucks.

I should've gone back to that series awful drunk posts I made that one time, fixed, clarified, and removed points, and posted this thread again myself...

>>15517126
>he fell for the "alternative medicine meme"
enjoy dying of curable cancer because you tried to cure it with a juice cleanse like the retard you are.

>>15517149
In fact OP fell for trying to use a weak argument that is easy to rebuke without more support.

>>15517156
hybrid foods apparently lead to vital electrics deficiency. If you’ve ever eaten a hybrid vegetable, be sure to get your electrics tested. It’s absolutely vital that you do. Fruitarian guru David Wolfe seems to be the source of this vital electrics business, and he’s also of the opinion that a hybrid fruit is to be avoided because “it is confused.”

>>15517184
>. If you’ve ever eaten a hybrid vegetable, be sure to get your electrics tested.
Do I just stick a bulb in my mouth or what?

>>15517135
>Ordinary plant breeding is exactly the same thing.
No it’s not, it’s not even close. Sorry faggot shill. You working at AECOM? They have the most retarded shills.

>>15517191
It all starts with knowing the ideal energy ratio and learning to understand what the variables represent when they are not ideal. Using simple urine and saliva testing to measure the variables, Dr Reams determined an energy equation for the line of least resistance of energy in humans; he reportedly never tested these variables mathematically to be false in his 50 years of research:

1.5brix 6.4urine pH/6.4saliva pH 6.5C (conductivity) 0.04M(cell debris) 3(nitrate nitrates)/3(ammonia nitrates) + CS (common sense)

>>15517197
>I don't have an argument so I'll just accuse him of being a shill!
Go back to Twitter with this shit retard

>>15516954
There is a difference between breeding seeds and crops and injecting them with artificial crap

every crop is gmo and every food is chemicals

>>15517109
>Guns germs steel by Jared diamond
Oh fuck off, don't shill this shit.

>>15517221
What's the difference then, pansy?

>>15517234
What's wrong with it

>>15517234
There's no reasonable criticism of it. All the hate it gets comes from woke leftists. It's a smear campaign.

>>15517212
You ARE a shill, only shills lie and say gene editing is the same as plant breeding.

And you are an AECOM employee, right? They tend to handle the big shills lately. They’re the ones who also always claim their cousin died at Sandy Hook.

What’s the pay like for AECOM shills?

>>15517236
There are several vegetables on the market that are hybrids. These vegetables do not supply the body with any nutrients. Some people believe they are eating healthy foods when infact they are eating man made hybrids such as Tofu and Soy.

>>15517236
It turns you into a tranny. You’ve obviously been munching on the GMOs yourself, we can tell you’re getting menstrual.

>>15517246
It’s never been proved to be safe.

Shove your frankenfood RIGHT UP YOUR ASS

>>15517247
What's the difference between plant breeding and gene editing, schizo? How does it make the crops unhealthy? Explain in detail, please.

>>15517240
Jared Diamond is a historically illiterate retard who generalizes and stereotypes as hard as any /pol/tard.

>>15517246
Of what, GGS or GMOs? I don't care about GMOs.

>>15517207
>he reportedly never tested these variables
I believe it.

>>15517264
Basic bio-electric chemistry rules include the following:

Any energy movement toward ideal = improved energy
No analytical number is perfect unless all of the numbers are perfect
Depletion of energy reserves = first day of disease
“You must get more energy from your food than what you consume.” (Carey Reams)

These rules support the Total Load theory that I first heard at NCNM, where one’s body has a threshold of stress, and when surpassed, the weakest or most burdened system begins to present with symptoms. Bio-electric chemistry monitoring of the variables not only shows us which system is showing the most stress, but also guides us as to what minerals and vitamins are needed to move the frequency pattern toward ideal.

>>15516954
I’m posting this first and reading the thread second, so apologies if someone else has said this, but you are wrong. Humans have been selectively breeding for years. GMOs are when humans insert the dna or rna of one organism into that of another. Literal gene splicing. The fact that so many people argue for gmos and don’t even realize this is the only thing I’m annoyed at. Love them of hate them, I can’t even imagine being such an idiot that I would argue a point without even knowing what the word means.

>>15517240
>>15517261
>Jared Diamond

>>15517184
>David Wolfe seems to be the source of this vital electrics business, and he’s also of the opinion that a hybrid fruit is to be avoided because "it is confused"
lol

Oh my God. If he had said "electrolytes" Iit could've at least looked like he was using real terms andaybe could've roped in a few more weirdo dummies.

>>15517144
confirmed for not understanding modern farming

>>15517137
Good argument fuckface.

>>15517071
>you just test the hybrid
That’s the issue. No testing or labeling is required.

Monsanto can fuck off but there's nothing actually wrong with GMOs as a concept

>>15517126
You know evolution is a random process, right?

>>15517297
Mutations are random. Evolution is selective.

>>15517248
>These vegetables do not supply the body with any nutrients.
source

>>15517115
Then go after Monsanto and ask for proper regulations. Don't go after GMOs as a whole.

GMOs are incredibly useful to us and the sooner we get them, the better.

>>15517314
Monsanto is GMOs as a whole.

>>15517248
Oh, so you are just trolling.
>>15517274
All of these points are obvious misrepresentations of what the book says or are just flat out wrong. For example, he addresses the grains available in America and that are in fact less nutritious and harder to grow than those in Eurasia. And the domesticable animals were killed tens of thousands of years ago, before farming

>>15517126
>mucus, which is the source of all ailments and disease.
I think bacteria and viruses are a pretty big cause.

>This is how Alkaline forming herbs, fruits, and vegetables help people heal from illness and prevent disease.
You know something can be alkaline enough to cause a chemical burn like an acid right? Of course herbs, fruits, and vegetables are still healthy but it seems like the focus on alkaline foods is from people only having a really simple understanding of what acidic means.

>>15517253
It’s different, it’s like the difference between; a woman giving birth, and a tranny sewing up pieces of children and shocking it to reanimate it, faggot.

Nobody wants GMOs. They exist solely so some Jew can squeeze another nickel from the goyim. And YES, Monsanto is Jewish.

>>15517314
Wrong, go after GMOs. Spread misinformation about how bad they are. Go over the top. After all, this ensures shills like you will have work, right?

Nobody wants your cheap garbage slop. GMOs are for golems.

>>15517115
>>15517314
Also, I just looked it up and Monsanto isn't even a goddamn company any more. I'm prettys sure I've heard the merr idea of not having modified crops produce seeds and controlling all that aused backlash, but that's more just something to look up I can't really be assed to check and it might not favor my position.

Either way, Monsanto is irrelevant. Just look at all the insane backlash they instilled. And they were forced to agree to a lot of shit.

Now all their products and shit have been aquired by Bayer, so their management and everything is completely irrelevant now.

>>15516954
What really makes anti-GMO retards look stupid is the ruby red grapefruit
>grapefruit is created by forced hybridization of 2 species, randomly mixing thousands of genes
>grapefruit is irradiated to force random mutations
>mutant seeds are planted
>ruby red grapefruit can be sold as "organic"
https://en.wikipedia.org/wiki/Mutation_breeding
Also, if a gene is deleted, and no foreign DNA is inserted, it still has to be called a GMO

>>15517248
>Tofu is a man made vegetable
shitposting retard

>>15517329
HEY EVERYBODY LOOK

A GPT-3 BOT

>>15517318
No it isn't. Monsan youto doesn't even exist as a company and terminator seeds, among many other things they did or tries to do, are no longer a thing.

>>15517345
So let’s label mutation-bred foods, we should require labeling for GMOs and mutation bred foods as well.

>>15517354
Monsanto merged with another evil company and now it’s called Bayer-Monsanto. It’s still every bit as evil, maybe even more so. And terminator seeds were taken off the market as there was an enormous outcry and it ended up being bad PR. They wanted to market the, but decided the bad press wasn’t worth it.

These are evil companies, filled with evil faggots. Never buy anything from them.

>>15517354
>>15517344
>evil multinational gets bought out by an even bigger multinational
>the problem doesn't exist anymore guise you can stop complaining!

I bet you think Blackwater stopped being evil when they renamed themselves to Xe or Academy or whatever, too.

>>15517126
nothing in this post has any scientific basis whatsoever

desu I'd prefer if all the pseudoscience new agers just performed straight-up magic rituals instead of confusing out of touch old people with this mumbo jumbo that's designed to sound scientific

>>15516954
>>15517345
Facts

>>15517009
>>15517072
>>15517272
They are the same, in any real sense. DNA is DNA, regardless of its "source". All living organisms use (virtually) the same DNA/protein framework, and codes from one work directly in another more often than not. The genes in question could, very plainly, "exist in nature" without human intervention. We just do the same thing nature does - but instantly, instead of waiting for it to assemble from random shuffling. The ONLY practical difference between the two processes is speed.

>>15516991
With genetic engineering, it's feasible.

>>15517026
Agreed. Shitty companies are shitty. I think GMOs suffer as a whole because people commonly conflate the two.

>>15517055
If vaccines were a new and untested product now, it would have the same response GMOs get. Look how prevalent antivaxxers are, DESPITE decades of proven results and widespread science education. GMOs don't inherently have anything to do with monopolies (that's a legal issue), and most "mutant" plants perform far worse in nature than the non-mutants.

>>15517115
Virtually all farmers buy their seeds every season already. Honestly, check it out. Most premiere crop traits don't last longer than one generation, so holding onto seeds is detrimental.

>>15517306
Evolution can very much be random. If a landslide happens to kill the only white-spotted members of a population, that group just evolved to not have any white spots. I am not being pedantic, that's definitionally evolution.

>>15517236
Read my post again and think what's the difference

>>15517395
>Virtually all farmers buy their seeds every season already
... because seed washers were harassed by Monstanto and eventually had to stop doing business.

>>15517395
>They are the same, in any real sense.
No they’re not, and nobody wants GMOs except AECOM and Bayer-Monsanto.

List faggot. We don’t need your frankenslop. And it’s quite probably poisonous, especially anything “roundup ready.”

>>15517417
source?

>>15517427
>And it’s quite probably poisonous
>protein is poison
sure thing kid

>>15517428
Many famous law suits, Monsanto would *claim* their patented material was in seeds and demand farmers engage in massive amounts of genetic testing to prove they weren’t. These cases were almost always in Illinois or Iowa, known for their crooked judges.

>>15517377
My point is that
>Monsanto had a lot of problems
>They were forced to change a lot
>Their attempts to monoplize food failed. Many of their products weren't even produced.
>They failed
>They no longer exist as a company.

People are aware of all the meme issues you go on about with monopolizing the food supply etc.. It's not gonna happen.

>>15517450
Cool FUD but just because they're called Bayer now doesn't mean they're not around anymore.

>>15517329
You’re just racist either implicitly or explicitly.

> Among some in the Black vegan community, alkaline eating has become more than a fad diet; it represents, to them, a radical act of self-care that rejects reliance upon a biased and discriminatory medical industry. For those influencers, the work of Alfredo “Dr. Sebi” Bowman, the Honduran herbalist and healer who began promoting an alkaline diet in the 1980s, is a key throughline. Dr. Sebi, who is self-educated and does not have a formal medical degree, is best known in the mainstream for his most fantastical claims — namely, for rejecting the germ theory of disease, which he posits stems from mucus, and that he has cured brain tumors, herpes, lupus, blindness, cancer, and AIDS. (The latter claim, his most notorious, resulted in two separate court cases in New York state; he was acquitted in a criminal case for practicing medicine without a license

>>15517415
>I've got no point and I know it

>>15517417
Well, if they chose to buy seeds with that restriction in place, then they agreed to those terms. Why would I be surprised if someone breaks a contract and gets taken to court?
The fact remains that most farmers buy seeds, even for conventional crops, because it is easier, less expensive, and results in higher quality plants.
Look into hybrid vigor - the majority of these benefits are lost to the offspring, even after just one generation.
"In the US, by 2014, 94% of the planted area of soybeans, 96% of cotton and 93% of corn were genetically modified varieties." (USDA)
Why would farmers, almost ENTIRELY, prefer GE crops if they were so bad? They pretty much only choose conventional crops if they are planning to try and sell to the organic market, where higher prices (sometimes) outweigh the higher costs and lower yields.

>>15517462
Why do shills think it’s a good idea to make up retarded lies all the time? I haven’t seen a good shill in ages. Too much affirmative action?

Why the duck do people think that GMOs can't legally ethical when we can literally use the same legal practices we use for ""normal"" bred crops?
The public already had a massive backlash on the very idea of terminator seeds. Like fuck off.

There's two groups here, right now I'm focusing on the legally minded retards.

I'm not going to bother with the health retards cuz once you've swallowed that shit and start distrusting science itself, there's nothing anyone can do for you.

>>15517479
That’s not what happened. Monsanto claimed that seeds other people grew contained their patented genetics. And they demanded seeds be tested at huge expense to “prove” there wasn’t. They used civil suits in front of friendly, bribed judges.

>>15517465
>Dr Sebi
>>>/x/

>>15517490
You’re not making any sense. Pajeet. Is English even your first language?

>>15517055
Other way around. Vaccine have many side effects and an inherent risk while there are none coming from GMOs
>inb4 muh Monsato
Monsanto is a corporation, not the GMO

>>15517497
1. Do you have a source for that? Every case I've been pointed to, it was pretty self-evident that the farmers were full of shit and were knowingly and intentionally growing the seeds.
2. What's the relevance anyway? I think Monsanto sucks ass. I'm defending the technology here; I think the US corporate / patent legal framework is total horseshit. It has no bearing on GMOs as a concept.

>>15517462
>Cool FUD
You don't seem to know what this acronym means. Nothing I said was fearmongering. I would've expected you to say something about me brainwashing people, maybe, as your go-to ad hominem, but you didn't even manage that.
>>15517462
>Just because they're called Bayer

Just because a completely different set of people have control over the production and use of everything that company used to own and do AND they failed to do anything they set out to do.

Bayer owns names. Things like Round Up are good names to own.
As I said, Monsanto is irrelevant. Most companies do not like failing and losing money. If it's a criticism of a company, it should be a criticism of a company that is currently doing something bad and their should be reasoning as to why you say it is bad.

>>15517126
>Whether it be GMO or hybridization, non-original foods create mucus, which is the source of all ailments and disease
Enjoy your ulcers and weak immune system

>>15517497
Not that poster, but why can't any anti-GMO argument exist without mentioning Monsanto?
Is it because luddites don't understand the science behind the technology, so they have to invoke a corporate boogyman
And no,I think Monsanto are a bunch of dicks, but Bayer is even worse

>>15517500
Black people aren’t paranormal. You’re just proving that you have a problem with black agency.

>Most provocatively, as an early proponent of the gut-brain connection, Dr. Sebi encouraged Black people to return to plant-based diets rooted in our ancestors’ place of origin. “Our mother [in Africa] didn’t have any … hog mogs and chitlins,” Sebi said. For people of African descent, he argued, meat and dairy — which were consumed sparingly in traditional African diets — harmed not only our physical bodies but our spiritual and mental well-being. “Dr. Sebi would always talk about how smart the Black man in America is,” filmmaker Abelardo “Mr. G” Guerrero Jr. recounts of his time traveling with Sebi in his book, My Journey with Dr. Sebi. “They give us all this stuff that clogs us up so that we don’t tap into our greatness.”

>Many Black plant-based eaters today, including me, have been galvanized by the frightening statistical pattern of life-threatening illnesses connected to diet and nutrition that affect our community at higher rates than other groups: cancer, obesity, hypertension, diabetes, and heart disease, to name a few.

>selectively combine desirable genetic traits into a viable offspring via bleeding-edge technology under ideal conditions
OMG EVIL

>(try to) selectively combine desirable genetic traits into a viable offspring via a combination of benis-in-vagene & hoping for the best
Just as science intended :)

>>15516954
Shut up Mike Tyson you retard

>>15517462
>>15517542
Furthermore, and importantly, they're not the only biotech firm that could produce GMOs if they were actually allowed to do under proper regulation.
The idea that Bayer could own the world food supply in this way is preposterous. After all, you've proven the point that if they DO pull shit, they face consumer backlash and people can buy non-GMO local shit for a while.
>B-but that's what I'm doing
No. You're attacking GMOs as a whole. You're buying products based on their degree of luddite FUD shilling. Maybe this can be justified if you don't like the companies making GMOs, but attacking the entire process of genetic engineering is bullshit.

>>15517536
Shhh.. dude, this is 4chan.
You can’t just ask someone to validate their assertion that an ebil corporation runs their trucks on biodiesel made from kidnapped children.
Because then they only have to reply
>defending Monsanto
And they automatically win the argument.

>>15516954
And the Agricultural revolution and its consequences have been a disaster for the human race

>>15517071
This anon gets it.

>>15517009
salmon and watermelons are exactly the same fucking thing, we are all made of star dust from trillions of years ago.

>>15516954

Americans think doing that is some evil scientist with needles and weird science. Cross breeding flowers at home is GMO.

>>15517071
ah yes and the fences of these so called test fields totally limit the spread of the experimental GMOs

>>15517290
If GMOs were labelled at this rate, they would end up illegal. The public is too stupid to not treat the genetically modified label as anything but a reputational tarnish because people like Jill Stein paid for them to think "GMO bad". Having no defence against the waves of loud people conflating GMOs with shitty companies, GMOs will eventually be made illegal on top of it all so the people saying their bad can squeeze every bit of clout out of the situation as they can.

>>15517465
I'm biplicit, actually.

>>15517143
>Dr Sebi
literal witch doctor shill pls go

>>15517290
They've already been shown to be healthy. If a given GMO item was not tested for health effects and they just put that shit on the shelves a d it was found to be toxic or something, it would only be a matter of some unknown and possibly very short amount of time before this leads to a tremendous shitstorm. Especially if it's a vegetable or something else well known to be healthy, because now the media has a vested interest in making stories off of that easily noticed irony.

>>15517536
>Do you have a source for that
Yes of course.

>>15517545
Monsanto’s responsible for most of the industry shilling (like yours) and so they will receive the brunt of the bad will.

>>15517798
the issue is biodiversity and the risk that a patented cultivar would spread.
Also
>trusting big food
every week they find a new cancer inducing shit that was deemed safe and half the time the people behind it knew about it

>>15517798
They have not been shown to be healthy and Monsanto has gone to great lengths to suppress the repeatable, verifiable carcinogenic activity of GMOs.

>>15517872
>Monsanto has gone to great lengths
how long have you been working as a community manager for Monsanto?

>>15517734
>I KNOW WHATS BEST FOR YOU!!!

You will be buried as a boy.

>>15517876
Hes been at it at least 6 years. Anytime Monsanto or GMOs gets mentioned this dickless loser wails about how everyone else is stupid and bought off for not accepting Bayer propaganda. A Gates funded fascist who should be killed.

>>15517876
>a community manager for Monsanto would point out the fact that their GMO poison causes cancer
So you’re admitting you’re a GPT-3 bot eh?

>>15517126
what in retardation

>>15517866
No source, your argument is invalid.

>>15518055
he's posting from an iphone the fuck did you expect

>>15517057
how can one genus be so based?

>>15518055
I’m not the one obsessed with sources. And you never offered any anyway. Nobody wants your GMO frankenfoods. Not even people on welfare.

>>15517951
>GPT-3 bot
I don't dabble in dweeb shit

>>15518151
You’re not very good at your job though. Might be good to read up on shillbots before you’re replaced by one, AECOM-chan.

>>15517872
>increasing the yield of a grain causes cancer
>the lack of proof is undeniable proof that there’s actually an abundance of proof, because it proves the proof is being suppressed

Literally impossible to refute. Monsanto BTFO.

>>15517126
shut up cultist
https://en.wikipedia.org/wiki/Talk:Alfredo_Bowman

>>15517009
lmao read a genetics 101 textbook
>>15517055
that's the fault of a corporation, not a hecking salmorino in my tomatorinos!!!

>>15516954
>Humans have been modifying the genetics of organisms plants for 12,000 years. It's called Agriculture.
Yeah, but it is far different doing so through artificial selection and doing so through genetic engineering.

Prove me wrong.

>>15517126
All food has been altered.
you telling me brussel sprouts, cabbage, broccoli, cauliflower, and kale are bad for you?
The wheat we consume today has changed like 7 times in the past 2000 years.
hell all bananas we eat today aren't even the same ones from 100 years ago.

>>15518371
>artificial selection
I'll give you genetic engineering, but I hear artificial selection get thrown around way too much.
All crops have been artificially selected, always have been, and probably always will.
A farmer saving seeds from his plants that grew bigger fruit is artificial selection, and there's nothing wrong with that.
honestly there's nothing wrong with genetic engineering either, but that's a touchy subject so I won't push it.

>>15518421
>A farmer saving seeds from his plants that grew bigger fruit is artificial selection, and there's nothing wrong with that.
Agreed.
>>15518421
>honestly there's nothing wrong with genetic engineering either, but that's a touchy subject so I won't push it.
Wrong and retarded.

Guess you are not capable of >>15518371
>Prove me wrong.

So yeah, you have no argument.

>>15518371
Let's say a crop "naturally" arises that happens to contain the following stretch of DNA, which turns out to have convenient anti-fungal properties:
ATGAATCGCCTACGTGGCTAC

Somewhere else, somebody in a lab decides to insert into the same crop an artificial stretch of DNA - into the same spot the above sequence exists:
ATGAATCGCCTACGTGGCTAC

The net result in both is an organism with a 100% identical genetic code. Go ahead and explain how these would, in any way, be something other than exactly the same plants.

>>15518543
>The net result in both is an organism with a 100% identical genetic code. Go ahead and explain how these would, in any way, be something other than exactly the same plants.
Sure thing! First of all, we are not talking about taking a gene from a crop and inserting it into other. Most of the GMOs are derived from genes obtained from species that do not belong to the plantae kingdom, but that is not even the point here...

The point is that the current process of genetic engineering is in itself flawed. All of the techniques are bound to have unwanted, unforseen effects that are most often than not harmful to either humans, the enviroment or to the plants themselves.

It is hardly a perfected science, we should not be allowing it to be used for crops destined to human consumption, that is a big mistake that has been done in the past and we are still paying for it in the form of increased likelihood of several kinds of cancer.

Not to mention the fact that most GMOs are from the "round-up ready" variety, which makes the plants immune to a herbicide that is extremelly harmful to the people consuming them, hence the aforementioned increase of likelihood of several kinds of cancer.

There are several studies on the topic, it is a fact that anyone who studied the field knows.

Here is a neat little movie about the company that first created GMOs: https://youtu.be/ho0BWyZHQ5Y

>>15518666
>species that do not belong to the plantae kingdom
It doesn't make a difference where the DNA came from; only how it functions in the destination. The sequence is just the letters. There isn't anything magical about where you got the letters.

>unwanted, unforseen effects
Like what? Keep in mind that when you are changing a single gene in an organism, you are doing pretty much exactly that - changing an almost infinitesimally small portion of the organism's genetic material. But when a farmer "conventionally" breeds two varieties together, he is shuffling both decks together, and the results are totally unpredictable. Which sounds more dangerous to you? The one that changes 0.0001% of the organism, or the one that changes 100%? There's no a guarantee that material suspected to be safe in two different crops will continue to be safe when the two are combined.

>>15518666
>increased likelihood of several kinds of cancer
I've never seen a paper stating this that hasn't been roundly discredited. Which makes sense, since there is nothing logical to support the idea (thus, not even a hypothesis) that eating a GMO would cause cancer. See my prior point.

>"round-up ready" variety
The trait itself doesn't make the plant dangerous to consume. I have no idea if the herbicide itself is, but it isn't relevant to the GE technology. For what it's worth, farmers are going to spread herbicides on their fields no matter what, and glyphosate is very likely less dangerous than conventional options.

>a fact that anyone who studied the field knows
I disagree completely, and I did study this field. I dropped out of the field partially due to misinformed Luddites killing off the potential of this technology (and, by extension, the many people worldwide that could have lived better lives through it - or just lived, period).

>neat little movie
That's 109 minutes long. The title itself appears to be sensationalist, so please forgive me if I do not give it the time of day.

>>15518856
>I've never seen a paper stating this that hasn't been roundly discredited.
Yeah, that is discussed in the documentary I shared and that you disregarded, the company is infamous for hiring shills to discredit any scientist who dares speak up against them.

Go ahead and ignore it, it seems you have a very biased opinion that is likely purely political rather than scientific.

>>15517039
lmfao

>>15516991
well we have cultivated one species like a thousand times

So y’all are saying Dr. Sebi was right and GMO food is not good for us?

>>15516954
There is a difference between making different plants fuck to putting spider silk in goat milk.
https://www.bbc.com/news/av/science-environment-16554357
Old article, but proof that the silkmilk isn't hyperbole.

Now I don't give a fuck about the silkmilk; if it works it works. I'm not gonna cry about GMOs, frankly I want them to splice the genetics for bioluminesence in everything because I grow my own fruits, veg, and herbs and I'd love my sunflowers to be ten feet tall and have petals that glow under the moonlight. On a more realistic sense, I'd just be happy if I didn't have to worry about mother nature sharting out one last cold-snap mid-spring and killing my sensitive plants, because they've been made SALMON STRONK. But GMOs aren't the same fucking thing as selective breeding, and the reason GMOs are evil is simply because the corporation shilling it is using it as a way to wield their patents like a fucking nuclear arsenal to monopolize people's ability to feed themselves.

>>15516954
Only a true retard could say something this stupid, even black science moron said it, that's how stupid it is.

>>15519214
Dr. Sebi was NOT a moron.

>>15517395
>Evolution can very much be random. If a landslide happens to kill the only white-spotted members of a population, that group just evolved to not have any white spots. I am not being pedantic, that's definitionally evolution.

No, because that's a one off event. There is no selective pressure against white spots since a subsequent landslide will destroy white spotted and non white spotted members. At the same time, gene expression is more complex than that.

>>15519603
That's the whole point of my post. Evolution is defined merely as a change in alleles within a population over time - by whatever means. Look up "genetic drift". This isn't a matter of opinion. Selective pressure is just one mechanism among several that can lead to evolution.

>>15516954

Nope.

GMO's are, by definition, organisms with a genome that has been modified with the use of certain, very modern genetic engineering techniques that did not exist at all until the late 1970s. There were no GMO crops before that.

>>15519952
But are GMO foods bad for us or nah?

>>15517135
>Ordinary plant breeding is exactly the same thing. Corn that big couldn't exist in nature, it requires more resources than it's worth evolutionary by many times. You're being retarded.

Bullshit.

In GMOs, genetic engineering techniques are used to insert genes from completely different species. Those genes can never get there by selective breeding.

That said, it is possible for genes to cross from one species to another by way of lateral gene transfer or horizontal gene transfer. It is very slow and haphazard. You could breed corn for a million years and never develop even one plant of bt-corn.

With modern genetic engineering techniques, we can select particular genes to insert into an organism now instead of crossing our fingers for millions of years and wishing upon a falling star.

>>15517253
>What's the difference between plant breeding and gene editing, schizo? How does it make the crops unhealthy? Explain in detail, please.

In selective breeding, you are combining genes from two closely related members of the same species.

In GMOs you are inserting genes or deleting genes from completely unrelated organisms -- for example, from bacteria into corn.

While there is nothing wrong with GMO, it is a highly ignorant argument to pretend that they are the same as selective breeding.

I love peanuts but have developed an allergy to them. I would really love to see GMO peanuts with the allergens removed. It is pretty much impossible for this to ever happen with selective breeding.

>>15517345

Radiation is not a technique of Genetic Engineering.

Can someone please answer if GMO crops are good or bad for people’s health?

>>15519960
>But are GMO foods bad for us or nah?

While it is theoretically possible to make GMO foods that are dangerous, there would be very little reason to do so. The GMO foods you buy are safe to eat.

I only eat non GMO to fuck "witchy" bitches from whole foods, leave me alone boomer.

>>15516954
I want to make tomatoes and trees as big as mountains

ITT: City slickers who have no idea how agribusiness works

Here's a quick rundown of a typical seed contract. It even includes scans of the actual document for you to check out. It's not as sinister as your online vegan mommy blogs make it out to be.

https://thefarmerslife.com/whats-in-a-monsanto-contract/

>>15520051
Then why do all these ITT faggots care so much? Isn’t the modification of crops in the 60s and 70s the reason why the world population exploded?

>>15517039
>mmm watermelmon

>>15520205
>Then why do all these ITT faggots care so much? Isn’t the modification of crops in the 60s and 70s the reason why the world population exploded?

The very first GMO food item was from something like 1994. Before that, there were no GMO foods.

We did have GMO mice before for years before that, but the mice are for research, not for food.

One of the great successes in food production of the 20th century was that by Nobel Laureate Norman Borlaug. He crossed the tall wheat in Mexico from which the heads tended to break off before harvest, drastically cutting the production, with a Japanese dwarf wheat. The result was a shorter, stouter wheat that would survive until harvest, thereby making Mexico a net exporter of what rather than an importer.

>>15517240
He's upset Jared Diamond doesn't endorse white supremacy.

What is very interesting.

Initially there was diploid and tetraploid wheat. Diploid wheat has two sets of the 7 chromosomes and tetraploid wheat has four sets of the 7 chromosomes.

It is thought that sometime around 10,000 or so years ago, an early farmer had a certain cereal grass that is a relative of the wheat in the field and by horizontal gene transfer, a set of chromosomes from the cereal grass entered the genome of the wheat.

Diploid wheat is basically used for animal feed and a certain rough bread where it is grown. The wheat used to make pasta is a tetraploid wheat.

It was hexaploid wheat that made civilization possible. It grows all over the world in a great many kinds of climate and its flour is used to make just about every kind of product using wheat flour in the world.

Anyway, one would not be able to produce hexaploid wheat by conventional breeding techniques. It was only the happy accident of horizontal gene transfer from the grass species to the tetraploid wheat that made hexaploid wheat possible.

With GMO, it should be possible to introduce the extra set of genes (2 each of the 7 wheat genes), but who would have ever thought of doing this?

>>15520677
Probably some mad scientist. For what it's worth, there are other examples known that would make people want to try it.

You can add treat plants with colchicine to trigger the retention of additional genome copies on-demand; plants seem to tolerate this well, and in fact, often grow faster and larger.

Modern strawberries are an example, they are octaploid, and presumably much larger than wild variants that are only diploid or tetraploid.

>>15520707

Thanks. That's an interesting thing to know.

>>15517274
>Why didn't Europeans hunt horses, cows and sheep to extinction.
Sheep are native to the Turkey and Horses are native to Central Asia. Also the wild progenitors of cattle (Aurochs) WERE hunted to extinction.

Also showing a Zebra pulling a cart shows that this moron does not understand the difference between tamed and domesticated.

>>15520787
>this moron does not understand the difference between tamed and domesticated.
anon it's a meme image

>>15516954
yes, but not all crops are altered so they don't die when you put round up directly in their water

>>15516954
>All crops are GMO
No, GMO shill, your poison is not the same as selective breeding

>Humans have been modifying the genetics of organisms plants for 12,000 years.
The planet is only about 6000 years old schizo, take meds

>>15516954
Retard, GMO means they directly modified the plant's DNA in a lab to produce a desired attribute

>>15521320
Please explain how GMOs are bad for you

>>15521328
leaky gut syndrome

>>15521334
Not even a real thing

Genetic engineering is what it is and the negatives depend on what they actually did, but in the case of agriculture it seems that a significant portion is intended to become resistant to glyphosate, which is a major toxin and is sprayed on the crops. Buying non gmo produce is a good way to avoid glyphosate.

>>15521324
So it's a more efficient form of agriculture that bypasses the need for endless crossbreeding.

>>15521324
Ahh so bombarding a plant with radiation and hoping for a positive mutation is fine but accurately modifying the DNA in a lab is bad.

>>15521334
>written by a failed politician with zero scientific credentials

Sounds legit.

Fun fact: with the advent of crispr and other advanced editing methods it will be impossible to legally prove whether an organism is genetically modified or not. The old methods relied on the functional sequences on the borders of the DNA that were necessary to insert genes and in the genome. CRISPR can just edit exactly what the user wants.

>>15521663
Neither is good for the end consumer when it allows you to blast plants with more pesticide without killing it. Further increasing our consumption of said pesticides the plant has accumulated inside and out. Unless people aren't worried about effects that don't show up within 48 hours.

>>15517109
>Guns germs steel by Jared diamond
Reddit nu-historian please go.

>>15520051
>The GMO foods you buy are safe to eat.
Why is Starlink corn not approved for human consumption by the FDA?

>guess what science denier I just ate this salmontomato and I'm not dead yet so there's nothing wrong with gmos, get wrecked facebook karen.

>>15517009
a watermelon with salmon meat as it's insides would be pretty good.
imagine the filets.

>>15517109
No, we got the ones that are really easy for primitive humans to start farming. There are a shitload of potentially edible plants that we could be farming, but they would require too much investment before they are as productive as corn or potatoes

>>15520205
Because autism and paranoid schizophrenia are endemic to 4chan users

>>15516954
mmhh yes, selective breeding is indeed the same thing as making crops resistant to fucking roundup

>>15522480
>>The GMO foods you buy are safe to eat.
>Why is Starlink corn not approved for human consumption by the FDA?

Are you buying it to eat?

>>15521704

CRISPR is the next thing after genetic engineering. Genetic engineering is rapidly becoming "yesterday's technology".

>>15524541
Yes, but the terminology is vague for the layman

>>15524748
Long word scurry, short word scurry, natural good, artificial bad, anthrax better than antibiotic.

>>15516984
GMO is not agriculture its modifying the genome with other species.
Such as fish, insect and other modifications.
Its not cultivation its abominations.
GMO forces the Gene to lose key defense and nutritions for the sake of apperance or product color.
Its not only wrong its crazy wrong.
It turns a creation of nature into a machine and unnatrual product for the sake of patents and patent law.
Now go take a long walk off a short pier.

>>15517018
That dog looks inbread lol

>>15525727
Hehe :)

gmo more like homo

>>15524748
>Yes, but the terminology is vague for the layman

That's a good point.

>>15524541
>>15524748
How, pray tell, is CRISPR not just the newest method of genetic engineering? Seeing as the latter just refers to using technology to modify the genetic material of an organism or lineage.

I'm not a layman, so feel free to explain this one in-depth.

>>15524916
Spotted the guy who doesn't know the first fucking thing about biology.

It’s really funny that so many of you racist fucks agree with Dr. Sebi about GMO crops. He literally found the cure for AIDS, cancer, herpes, etc. but you’re only willing to listen to him when it comes to GMOs. Lmao

>>15526214
>How, pray tell, is CRISPR not just the newest method of genetic engineering? Seeing as the latter just refers to using technology to modify the genetic material of an organism or lineage.

That's a good question. With the genetic engineering techniques to create GMOs, we bring in genes from entirely different species. With CRISPR technology, we can edit the genes without introducing new genes from elsewhere.

>>15526214
Point is, crispr can edit the exact dna bases, while older technology needed to insert extra DNA as part of the process
So whereas a crispr gene looks like this:
>[Gene]
A gmo gene looks like this:
>[INSERTION SEQUENCE][gene][INSERTION SEQUENCE]
With crispr, even if you have your suspicions, you can't legally prove that it's GMO and regulatory bodies will face new challenges. This was explained to me by the head of the board of genetic technology in my country, so it's not just my own theories.

>>15517071
NOOOOOOOOO THEY'RE PUTTING CHEMICALS IN THE FOOD THAT GIVES YOU GAY AUTISM

>>15517055
https://www.cdc.gov/vaccines/parents/why-vaccinate/vaccine-decision.html

https://www.cdc.gov/vaccinesafety/vaccines/index.html

Both sides are stupid people. Of course vaccines can have negative effects.
Jesus Christ.

There are so many ways to argue IN FAVOR of GMO, and of course OP had to start with an 80 IQ take.